1 / 18

DNA Gel Electrophoresis: Solving Mysteries & Unraveling Relationships

Discover how DNA gel electrophoresis aids in solving crimes, proving guilt, and identifying relationships among living organisms. Learn about the process and uses of DNA fingerprinting to unveil unique genetic codes.

geraldtran
Télécharger la présentation

DNA Gel Electrophoresis: Solving Mysteries & Unraveling Relationships

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. GEL ELECTROPHORESIS

  2. Gel electrophoresis is a process used by scientists to separate mixtures of molecules by size, creating a DNA “fingerprint” • It is most often used to separate molecules of proteins and molecules of DNA

  3. Everyone has their own unique DNA (unless you have an identical twin) This is what makes it very useful as evidence for solving crimes. DNA GEL ELECTROPHORESIS

  4. DNA gel electrophoresis produces a banding pattern that looks like a bar code, which is unique to each person. This is the DNA fingerprint or profile.

  5. Prove guilt by matching DNA found at a crime scene to a suspect Exonerate an innocent person Paternity testing Identification of John or Jane Does . Uses of DNA Profiles

  6. Determine current and evolutionary relationships among living things Determine and identify the genes responsible for certain inherited disorders Uses of DNA fingerprinting

  7. The Process of Electrophoresis • Special enzymes called restriction enzymes are used to cut DNA in specific places (biological scissors)

  8. XBAM111 IS AN RESTRICTION ENZYME THAT CUTS BETWEEN GGCC • ATGGCCTAAAAGGCCATGGCCAGACC • ATGG/CCTAAAAGG/CCATGG/CCAGACC

  9. This produces DNA fragments of different lengths • ATGG/CCTAAAAGG/CCATGG/CCAGACC • ATGG • CCTAAAGG • CCATGG • CCAGACC • These pieces of DNA will be different in each person due to their unique genetic code

  10. Process of Electrophoresis • The DNA samples are loaded into wells in a gel that is located in a gel box

  11. The gel box has 2 electrodes, one positive and one negative and is attached to a power source

  12. The electric current is turned on

  13. Since DNA has a negative charge it will move toward the positive electrode

  14. The size of a DNA fragment depends on how many base pairs it contains • ATGG • CCTAAAGG • CCATGG • CCAGGCC

  15. The smaller base pairs move faster and farther through the gel

  16. The distinct pattern or “fingerprint” that is made becomes visible to the human eye by staining and/ or using ultraviolet light

  17. The DNA patterns are now compared for similarities and differences

More Related