220 likes | 364 Vues
Characterization of the caprine PrP Gene:. Study of new polymorphisms and relationship with the resistance/susceptibility to the scrapie disease. University of Zaragoza (Spain). http://www.tiho-hannover.de/einricht/zucht/eaap/descript/303.htm. Sheep scrapie susceptibility: Codon 136 (A V)
E N D
Characterization of the caprine PrP Gene: Study of new polymorphisms and relationship with the resistance/susceptibility to the scrapie disease University of Zaragoza (Spain) http://www.tiho-hannover.de/einricht/zucht/eaap/descript/303.htm
Sheep scrapie susceptibility: Codon 136 (AV) Codon 154 (RH) Codon 171 (QR; QH) Goat scrapie susceptibility is linked to PrP gene polymorphisms? Introduction Hunter el al. (1994)
143H 154R I.P. 102G 142M I.P. Goldmann et al., 1996 and 1998; Billinis et al., 2002 Introduction Goat PrP gene polymorphisms
Octapeptide region: 3 repetitions susceptibility 5 repetitions Introduction Goat PrP gene polymorphisms Goldmann et al., 1996 and 1998; Billinis et al., 2002
Introduction Goat scrapie in Spain • Past: several scrapie animals belonging to mixed flocks (sheep + goats); • 2002: A scrapie goat in a herd composed of Alpine and Saanen goats.
Objectives • Identify the scrapie affected goats in the herd. • Analyse the PrP sequence in the scrapie and healthy goats belonging to the herd. • Compare allele frequencies from the herd with healthy Alpine and Saanen populations. • Determine PrP polymorphism in native breeds.
Animals • Natural scrapie infected herd: • Saanen (n=49), Alpine (n=48) and cross-breed (n=5)
Animals • Natural scrapie infected herd: • Saanen (n=49), Alpine (n=48) and cross-breed (n=5) • Healthy control herds: • Saanen (n=42, 4 herds) • Alpine (n=39, 5 herds)
Animals • Natural scrapie infected herd: • Saanen (n=49), Alpine (n=48) and cross-breed (n=5) • Healthy control herds: • Saanen (n=42, 4 herds) • Alpine (n=39, 5 herds) • Native goats: • Moncaina (n=41, 7 herds) • Pirenaica (n=21, 1 herd)
1 Alpine 1 Saanen Scrapie diagnosis • Clinical symptoms. • Western Blotting. • Immunohistochemistry.
Goat PrP gene analysis • DNA extraction: • Blood • Brain tissue • Sequencing (Goldmann et al., 1996): • 20 fwd: • 5’ATGGTGAAAAGCCACATAGGCAGT3’ (20-42) • 767 rev: • 5’CTATCCTACTATGAGAAAAATGAG3’(789-767) • Statistical analysis: • 2 test (Yates correction)
Alpine 211: CGA/CAA Arg/Gln PrP polymorphism in scrapie goats Saanen 142: ATA/ATG Ile/Met Silent Pol: 42: CCA/CCG (Pro) 138: AGT/AGC (Ser)
PrP polymorphism in the scrapie herd Saanen 18:TGGCGG TrpArg 142: ATAATG IleMet 211: CGACAA ArgGln Silent Pol: 42: CCACCG (Pro) 138: AGTAGC (Ser) Alpine 18: TGGCGG 127: GGCAGC TrpArg GlySer 142: ATA/ATG 154: CGTCAT IleMet ArgHis 211: CGACAA 219: ACCATC ArgGln ThrIle 222: CAGCTGSilent Pol: GlnLeu 42: CCACCG 232: GGGCGG (Pro) GlyArg 138: AGTAGC (Ser) 211: TTCTTT (Phe) Crossbreed: No polymorphism
40 35 30 25 20 15 Alpine - 10 Alpine + 5 Saanen - * 0 ** RR Saanen + RQ QQ Significant differences between scrapie and healthy Saanen herds (* p < 0.05; ** p < 0.01). Comparison between scrapie and control herds Codon 211 Alpine positive goat: 211RGQ
45 40 35 30 25 20 15 Alpine - 10 Alpine + 5 Saanen - * 0 * II Saanen + IM MM Significant differences between scrapie and healthy Saanen herds (* p < 0.05). Comparison between scrapie and control herds Codon 142 Saanen positive goat: 142IM
6 New goat PrP polymorphisms 18 W R 1 MVKSHIGSWI LVLFVAMWSD VGLCKKRPKP GGGWNTGGSR ..........................................................A...P............................................... 41 YPGQGSPGGN RYPPQGGGGW GQPHGGGWGQ PHGGGWGQPH .....................S............................................................................................... 81 GGGWGQPHGG GGWGQGGSHS QWNKPSKPKT NMKHVAGAAA .................................................................G.................................................. 121 AGAVVGGLGG YMLGSAMSRP LIHFGNDYED RYYRENMYRY ...........................................................MR............................H................ 161 PNQVYYRPVD QYSNQNNFVH DCVNITVKQH TVTTTTKGEN ..................Q............................................................................................. 201 FTETDIKIME RVVEQMCITQ YQRESQAYYQ RGASVILFSS ....................................................H.......................................................P 241 PPVILLISFL IFLIVG ....................................... 127 G S 142 I M 154 R H 219 T I 222 Q R 232 G R 211 R Q Silent mutations: 42: CCACCG 138: AGTAGC 201: TTCTTT
PrP polymorphisms linked to scrapie susceptibility • Codon 211: • Alpine positive animal 211QR; • Significant differences between scrapie and control herds; • Homologous to human codon 208: • Human polymorphism RH associated with Creutzfeldt-Jakob disease in patients 129MM (homologous to goat codon 132 which is not polymorphic). • Codon 142: • Saanen positive animal 142MI.
National Reference Centre for TSE: Cristina Acín Eva Monleón Juan J. Badiola Acknowledgements: Silvia Ruiz, Nuria Segovia, Carmen Cons EET2001-4033 Biochemical Genetics Laboratory: Clemen Rodellar Pilar Zaragoza DGA and MEC Aragón and Asturias Regional Governments Ramón y Cajal Program Research Group - Inma Martín-Burriel