gilead
Uploaded by
16 SLIDES
358 VUES
180LIKES

DNA Forensics

DESCRIPTION

DNA Forensics. How DNA is used Ethical Issues. By : Daniel DiCenzo. What is DNA?. DNA - Deoxyribonucleic acid DNA is the blueprint for the design of our bodies Consists of certain base pairs that form specific sequences These sequences can code for specific amino acids

1 / 16

Télécharger la présentation

DNA Forensics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Forensics How DNA is used Ethical Issues By : Daniel DiCenzo

  2. What is DNA? • DNA - Deoxyribonucleic acid • DNA is the blueprint for the design of our bodies • Consists of certain base pairs that form specific sequences • These sequences can code for specific amino acids • These amino acids combine to form proteins • The proteins together make our entire body • Everyone’s DNA is unique • DNA holds all of the information needed to make living things

  3. What is DNA used to do? • Code for amino acids in our bodies • Act as a bar code that identifies who we are (DNA Fingerprint) • DNA can be analyzed and compared to other DNA • Comparing DNA can be used for many purposes • To match and analyze people’s DNA, scientists must perform special tests

  4. What Are These Tests • There are many ways to process DNA • Polymerase Chain Reaction (PCR) • Restriction Fragment Length Polymorphism (RFLP) • Short Tandem Repeat (STR) • Mitochondrial DNA (mtDNA) • DNA is taken from mitochondrion instead of nucleus

  5. Polymerase Chain Reaction • To put it simply PCR’s are used to amplify a certain piece of DNA • The initial piece of DNA is separated into two strands • RNA primer is attached at specific spot on DNA • DNA polymerase adds base pairs to both single stranded DNA • The product is two identical pieces of double stranded DNA • This process is repeated many times to achieve a large amount of DNA • The amount of DNA produced after every cycle however increases exponentially • This process allows a large amount of DNA to be produced from only a minute sample collected http://campus.queens.edu/faculty/jannr/Genetics/images/dnatech/FG12_11cPCR2.JPG

  6. Restriction Fragment Length Polymorphism • DNA is cut at specific points into fragments • These fragments are then put in a gel • Via “gel electrophoresis” the DNA fragments travel across the gel and stop at specific distances • DNA can be compared to other DNA run through this same method • This process however requires a large amount of DNA sample http://www.ars.usda.gov/pandp/docs.htm?docid=11828

  7. Short Tandem Repeat • Example of a tandem repeat • TAAGCTAAGCTAAGCTAAGC • In this tandem repeat – TAAGC is repeated four times • Every person’s DNA contains these tandem reapeats • These are inherited from your mother and your father • These are used in identification because they are very unique in individuals • Scientists analyze 13 loci in our DNA, this prevents any doubt that someone else shares these same genes • If only 2 loci are analyzed the probability that someone else shares those genes are much higher which is not effective in identifying people using DNA

  8. What are these fingerprints used for? • DNA fingerprinting has many uses • DNA fingerprinting has the ability to: • Prove someone is guilty/innocent of a crime • Instantly find the culprit if they are in a DNA database • Identify unknown bodies (old or new) • Determine who the father of a baby is (Paternity Test) • Find an organ match for a person • Catch poachers hunting and selling the meat of endangered animals

  9. Ethical Issues • DNA identification Act (1998) • Forces all those in Canada who have been convicted of a certain crime to be entered into the National DNA Databank (NDDB) • This is also the case in the U.S. • In 1998, all 50 states used their DNA databank, known as the National DNA Index System (NDIS) • Having to be forced to provide DNA is a violation of human rights, even if you are a criminal • Many believe in the future, everyone’s DNA will be on file • All of our most valuable secrets are exposed • Many believe this is an invasion of privacy • Our DNA can predict how we will die, do we want that information?

  10. Genetic Discrimination • DNA holds secret to almost every weakness you have • By allowing Insurance companies, employers, schools or banks access to any illness or flaw that you will, may or already have, you can be denied instantly • Government can learn anything about you without your consent • Those with “Good” DNA will be given better opportunities and success than those with “Bad” DNA • This will lead to a new discrimination, not by race or religion, but by your DNA

  11. Is DNA fingerprinting Reliable? • People have come to believe that DNA evidence is indisputable in courtrooms (Too much faith in DNA) • Human error is always a factor • Contamination of evidence • Labs are too pressured by police to give them the evidence they want to close the case • With more strict regulations on the quality of labs and technological advances, human error will be greatly reduced • Planting of evidence is a new problem • This always leaves doubt into the reliability of DNA evidence • Must look for probable cause in a case and not rely solely on DNA evidence

  12. DNA Databanks • There are approximately 200 000 people in the Canadian National DNA Databank • To this date there have been 10 000 offender hits because of this system • In the U.S., 6.5 million people have been entered into their national DNA databank • This databank is the largest in the world and has participated in over 77 000 investigations

  13. Taken from NDDB statistics page http://www.nddb-bndg.org/stats_e.htm

  14. Taken from NDDB annual report for 2006/2007 http://www.nddb-bndg.org/an_report_e.htm

  15. Conclusion • DNA holds all of the secrets of our bodies • There are many ways that DNA can be used to identify and learn about other people • It is an effective tool in crime solving • The use of DNA databanks has caused major concern over the civil rights of convicted felons and possibly in the future, the civil rights of everyone • If people’s DNA is exposed, there is concern for our privacy being violated

  16. Bibliography • Federal Bureau of Investigation. (2008). CODIS – NDIS Statistics. Retrieved December 9, 2008, from: http://www.fbi.gov/hq/lab/codis/clickmap.htm • Fink, Sheri. (2006, July). Reasonable Doubt. Discover, 27(7), 54-59. Retrieved from EBSCO host database. • Fridell, Ron. (2001). DNA Fingerprinting The Ultimate Identity. Toronto: Franklin Watts. • Genge, N.E. (2002). The Forensic Casebook. New York: Ballantine Publishing Group. • Human Genome Project Information. (2008). DNA Forensics. Retrieved November 10, 2008, from: http://www.ornl.gov/sci/techresources/Human_Genome/elsi/forensics.shtml#1 • Lampton, Christopher. (1991). DNA Fingerprinting. Boston: Christopher Lampton. • Learn Genetics. (2008). Can DNA demand a verdict?. Retrieved December 1, 2008, from: http://learn.genetics.utah.edu/content/labs/gel/forensics/ • National DNA Databank. (2006). Welcome to the National DNA Databank Website. Retrieved November 20, 2008, from: http://www.nddb-bndg.org/main_e.htm • Zonderman, Jon. (1990). Beyond the Crime Lab. Toronto: John Wiley and Sons.

More Related