glenna-murray
Uploaded by
22 SLIDES
325 VUES
220LIKES

Introduction to Python: A Beginner's Guide

DESCRIPTION

Learn the basics of Python programming language - from loops and functions to modules and imports. Discover the power and simplicity of Python with practical examples. Start your Python journey today!

1 / 22

Télécharger la présentation

Introduction to Python: A Beginner's Guide

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Introduction to Python September 26, 2011

  2. Bioinformatics Languages Low-level, compiled languages: C, C++, Java… Pros: performance Cons: slower programming (harder to both write &read) Statistical languages: R, MATLAB, Octave… Pros: many functions are provided. Cons: limited applicability to non-statistical problems (and some major ones are non-free). Scripting languages: Python, Perl, Ruby... Pros: fast programming. Python is easy to read. Cons: slower run times and larger memory footprint (sometimes by orders of magnitude).

  3. Python Started in 1989. Currently in version 2.7/3.3 More than most languages – very readable & clear "There should be one – and preferably only one – obvious way to do it." Like most scripting languages: Interpreted Garbage Collected (no need for memory management) High memory usage (wasteful)

  4. Printing and Loops Suppose we want to evaluate the expression x2 – 5 for the integers 0 through 4 A built-in Python function. Evaluates to a list of integers: [0, 1, 2, 3, 4, 5, 6, 7, 8, 9] A Python keyword indicating a loop. Other option for loops is while. A Python list. Like an array in other languages. Indicated by the brackets. -5 -4 -1 4 11 Four spaces. In Python, whitespace matters. Shows block structure. for x in [0,1,2,3,4]: result = x**2 – 5 print result Colon shows beginning of block. Single equals sign assigns value to variable A built-in function. Prints to stdout.

  5. Running Python Interactively Start the Python interpreter: $ python Enter commands at >>> prompt.

  6. A Python Program Structure of a program:

  7. A Python Program Write program in editor of your choice. There are many options See http://stackoverflow.com/questions/60784/poll-which-python-ide-editor-is-the-best

  8. Declaring a function Suppose our goal is similar, but we want to separate the details of the calculation into a function. The name of the function. A Python keyword indicating a new function. The parameters to the function. def little_function(n): return n**2 – 5 for x in [0,1,2,3,4]: result = little_function(x) print result A Python keyword indicating the vale to return. We replace our previous expression with a function call.

  9. Modules and Imports Now suppose instead of finding x2-5, we want to find log(x) Python has “batteries included”, meaning it has a broad standard library The name of the module to import. In this case, we're using math. Other common standard library modules include sys, os, re, datetime, and zlib. Python keyword at beginning of file to make a module available. import math def little_function(n): return math.log(n) for x in [0,1,2,3,4]: result = little_function(x) print result Dot is member access/ scope operator in Python

  10. Conditional Statements Python uses if/elif/else Suppose we want to print “Less than zero.” or “Zero.” rathen than the value. import math def little_function(n): return math.log(n) for x in [0,1,2,3,4]: result = little_function(x) if result < 0: print “Less than zero.” elif result == 0: print “Zero.” else: print result If blocks use same colon and indent rules as for loops. Elif and else are optional. Double equals tests for equality.

  11. Modules and Imports Now suppose instead of finding x2-5, we want to find log(x) Python has “batteries included”, meaning it has a broad standard library The name of the module to import. In this case, we're using math. Other common standard library modules include sys, os, re, datetime, and zlib. Python keyword at beginning of file to make a module available. import math def little_function(n): return math.log(n) for x in [0,1,2,3,4]: result = little_function(x) print result Dot is member access/ scope operator in Python

  12. Strings s = 'Hello' print s[0] print s[4] print s[-1] print s[1:3] print s[2:] print s[:3] print s[::2] print s[::-1] print len(s) Single or double quotes denote a string 'H' Brackets access characters of the string by index: 'o' 'o' 'el' 'llo' “Slices” can be taken with indices separated by a colon 'Hel' 'Hlo' Third term in slice determines step size. 'olleH' 5 len() gives length of string.

  13. String Methods s.lower(), s.upper() -- returns the lowercase or uppercase version of the string s.strip() -- returns a string with whitespace removed from the start and end s.isalpha()/s.isdigit()/s.isspace()... -- tests if all the string chars are in the various character classes s.startswith('other'), s.endswith('other') -- tests if the string starts or ends with the given other string s.find('other') -- searches for the given other string (not a regular expression) within s, and returns the first index where it begins or -1 if not found s.replace('old', 'new') -- returns a string where all occurrences of 'old' have been replaced by 'new' s.split('delim') -- returns a list of substrings separated by the given delimiter. The delimiter is not a regular expression, it's just text. 'aaa,bbb,ccc'.split(',') -> ['aaa', 'bbb', 'ccc']. As a convenient special case s.split() (with no arguments) splits on all whitespace chars. s.join(list) -- opposite of split(), joins the elements in the given list together using the string as the delimiter. e.g. '---'.join(['aaa', 'bbb', 'ccc']) -> aaa---bbb---ccc

  14. Practice Write a function that takes a string and returns another string consisting of the first two and last two characters of the input string. If the input string has fewer than two characters, return an empty string. Write a function that takes two strings and returns the number of times the second string appears in the first.

  15. Lists Lists in Python are similar to arrays in other languages z = [17,19, 23, 29, 31] print z[0] print z[4] print z[-1] print z[-3] print z[1:3] print z[2:] print z[:3] print z[::-1] print range(5) Square brackets indicate list. 17 Brackets also access elements in the list. Note they are 0-indexed. 31 31 Negative index starts from end. 23 [19, 23] Colon inidicates “slice” from list. [23, 29, 31] [17, 19, 23] [31, 29, 23, 19, 17] Idiom for reversing a list. [0, 1, 2, 3, 4] range(n) return a list of integers

  16. List Methods list.append(elem) -- adds a single element to the end of the list. Common error: does not return the new list, just modifies the original. list.insert(index, elem) -- inserts the element at the given index, shifting elements to the right. list.extend(list2) adds the elements in list2 to the end of the list. Using + or += on a list is similar to using extend(). list.index(elem) -- searches for the given element from the start of the list and returns its index. Throws a ValueError if the element does not appear (use "in" to check without a ValueError). list.remove(elem) -- searches for the first instance of the given element and removes it (throws ValueError if not present) list.sort() -- sorts the list in place (does not return it). (The sorted() function shown below is preferred.) list.reverse() -- reverses the list in place (does not return it) list.pop(index) -- removes and returns the element at the given index. Returns the rightmost element if index is omitted (roughly the opposite of append()).

  17. Practice Write a function that takes a list of strings, return a list with the strings in sorted order, except group all the strings that begin with 'x' first. Write a function that takes a list of numbers and returns a list where all adjacent == elements have been reduced to a single element, so [1, 2, 2, 3] returns [1, 2, 3].

  18. Dictionaries Python's key/value hash table is called a dictionary d = {} d['a'] = 'alpha' d['g'] = 'gamma' print d['a'] print d['z'] if 'z' in d: print d['z'] print d.keys() print d.values() print d.items() Curly braces indicate a dictionary Associate keys with values 'alpha' Retrieve values associated with keys KeyError Check if key in dictionary. ['a', 'g'] ['alpha', 'gamma'] [('a', 'alpha'), ('g', 'gamma')]

  19. Files Files in Python are generally handled line by line open returns a file object f = open('file.txt', 'r') outf = open('output.txt', 'w') for line in f: print line outf.write(line) f.close() outf.close() wholefile = file('file.txt').read() oneline = file('file.txt').readline() The second argument to open sets the mode. 'r' means read, 'w' means write. Note the write mode completely overwrites an existing file. You can iterate through lines in a file using a for loop. The write method of a file object in write mode writes a string to the file. You can use the shorter file(filename) syntax to get a file object in read mode. The read method with no arguments returns the contents of the whole file. The readline() method returns a single line from a file object.

  20. Command Line Arguments The sys module has a list called argv that contains the arguments used at the command line. import sys def main(word_to_print): print word_to_print if __name__ == '__main__': print sys.argv main(sys.argv[1]) ['scriptname.py', 'argument1', 'argument2', ...] Here select the second element of the list since we don't care about the name of the script.

  21. Practice Sequencing data comes in files in the FASTQ format: Write a program that reads a FASTQ file and writes only the reversed sequences to another file. The names of in input and output files should be passed as command line parameters. @SEQ_ID1 GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 @SEQ_ID2 AGTGCGGGAAATATCACCGTACATTCATCGCCCCCCTGAACAATACCCATAGATCACTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 ...

  22. Getting Help Python has an online tutorial and reference at http://docs.python.org/ The “help” command gives help in interactive mode: Google “python” + your question For windows users: http://www.richarddooling.com/index.php/2006/03/14/python-on-xp-7-minutes-to-hello-world/ help(len) len(...) len(object) -> integer Return the number of items of a sequence or mapping.

More Related