gryta
Uploaded by
21 SLIDES
356 VUES
210LIKES

A Web-based Software Tool for Designing Small Interface RNA

DESCRIPTION

This web-based software tool facilitates the design of small interfering RNA (siRNA) to silence specific genes, based on established bioinformatics algorithms. It leverages principles from the Central Dogma of Molecular Biology, highlighting the significance of gene silencing in genetic disorders and therapeutic applications. Users can input various parameters to generate siRNA sequences tailored to their needs while adhering to rational design criteria. The tool also incorporates mechanisms of RNA interference, enhancing research into chronic pain relief and other conditions.

1 / 21

Télécharger la présentation

A Web-based Software Tool for Designing Small Interface RNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. A Web-based Software Tool for Designing Small Interface RNA Blake Adams Graduate Student Department of Computer Science Advisor: Dr. Muhammad A. Rahman

  2. Overview • Central Dogma of Molecular Biology • Gene Silencing • siRNA • P2X3 • Rational Design • Thermodynamics • Web-based Interface Demonstration • Q&A

  3. DNA and RNA • DNA • Double Helix • adenine ,guanine, cytosine,thymine • Sugar is deoxyribose. • Mainly acts as a set of directions • RNA • Single Strand • Uracil replaces thymine • Sugar is ribose • Can take on several different roles

  4. The Central Dogma of Molecular Biology • DNA contains the complete genetic information that defines the structure and function of an organism • Proteins are formed using the genetic code of the DNA • Different processes are responsible for the inheritance of genetic information and for its conversion from one form to another • Replication : a double stranded nucleic acid is duplicated to give identical copies. This process perpetuates the genetic information. • Transcription : a DNA segment that constitutes a gene is read and transcribed into a single stranded sequence of RNA. The RNA moves from the nucleus into the cytoplasm. • Translation : the RNA sequence is translated into a sequence of amino acids as the protein is formed. During translation, the ribosome reads three bases (a codon) at a time from the RNA and translates them into one amino acid

  5. Genetic Disorders A genetic disorder is a disease caused by abnormalities in an individual’s genetic material (genome). There are four different types of genetic disorders: single-gene - cystic fibrosis, sickle cell anemia, Huntington’s disease. Multifactorial - heart disease, high blood pressure, arthritis, diabetes, cancer, and obesity. Chromosomal - Down syndrome Mitochondrial – Alzheimer’s disease

  6. Gene Silencing • Targeting or interfering with a specific gene and preventing its expression (in other words, preventing it from leading to a protein.) • One method for silencing these genes is RNA interference…

  7. What is RNA Interference? A phenomenon in which the introduction of double-stranded RNA into a cell causes degradation of the complementary mRNA. Since the mRNA becomes degraded, it is no longer capable of translating the data recorded from DNA, thus the gene is no longer producing it’s unique protein, and it’s effect is silenced.

  8. siRNA Mechanism • 2 Step Process • Initiation • Generation of siRNA snippets • Effector • Degradation of target mRNA

  9. Initiation Step Double Stranded RNA DICER siRNA

  10. Effector Step siRNA RNA Induced Silencing Complex (RISC)

  11. History of siRNA • 1995 – Gou & Kemphues notice gene silencing effect during an experiment with Caenorhabditis elegans. They do not know why it is occurring but make note of the phenomenon • For the next 3 years: “The basis of the sense effect is under investigation…” • 1998 – Fire & Mello verify silencing of C. elegans “a few dsRNA molecules are sufficient to silence the homologous gene’s expression.”

  12. My Interest in gene silencing • Bioinformatics – Fall 2004 • siRNA sequences are collected from relevant papers. • A scoring algorithm is developed based on prevailing design standards and techniques. • The scoring system is incorporated into a perl program designed to score siRNAs.

  13. P2X3 – A gene silencing example • “siRNA relieves chronic neuropathic pain” • Gabriele Dorn et al, Nucleic Acids Research, March 2004. • P2X3 – is a gene present in the Rattus norvegicus genome (rat) that plays a role in neuropathic pain (e.g. Arthritis). • Development and injection of an effective siRNA caused subjects suffering from Arthritis (identified by frequency of paw-licking) to lick paws less often and urinate with less frequency leading the researchers to conclude that silencing P2X3 has not only a significant effect on Arthritis but could also be used as a treatment for incontinence.

  14. siRNA – Good Design • Any given gene can be thousands of nucleotides in length. • What segment should be targeted? • Cost of purchasing siRNA to use in wet lab after design is quite high, a single sample can cost as much at $1000. • Time investment by scientists is increased for each unsuccessful siRNA used.

  15. Rational Design • 30 % - 52% G/C Content • Three or more A/U’s at Positions 15-19 (sense) • Absence of internal repeats • A at position 19 of the sense strand • A at position 3 of the sense • U at position 10 of the sense • No G/C at position 19 of the sense • No G at position 13 of the sense. • Reynolds, A. et al.(2004) Nature Biotechnology 22, 326-330 • Lays out 8 key factors that significantly improve the probability of selecting functional siRNA sequences

  16. Thermodynamics • Recent experimental evidence indicates that the two strands in the siRNA duplex do not enter into the RISC equally • The less stable 5’ end (of the sense OR antisense) in the siRNA duplex directs the strand to enter into the RISC complex. • Two recently published papers by Schwartz, et al. (Asymmetry in the assembly of the RNAi enzyme complex) and Khvorova et at (Functional siRNAs and miRNAs exhibit strand bias) demonstrate that it is the antisense strand of the siRNA that must bind to the RISC complex AND that energy differences between the sense and antisense (sense energy – antisense energy) tend to favor the sense when the outcome is positive. It is therefore favorable to select a sequence with a negative differential.

  17. Calculating a Thermodynamic Score • Thermodynamic parameters have been established and reported Xia et al. (Biochemistry 1998, Thermodynamic Parameters for an Expanded Nearest-Neighbor Model for Formation of RNA Duplexes with Watson-Crick Base Pairs) • For a given set of Neighbors in a sequence such as AG, there is an established energy value (-2.08). Each possible combination of AGTC (20 in total) has a fixed energy value. Dangling nucleotides also have fixed energy values. • A scoring system developed by Yuan et al. (Nucleic Acids Research 2004, siRNA Selection Server: an automated siRNA oligonucleotide prediction server) establishes a system based on these values to determine the Energy score of the sense and antisense strand of a given siRNA strand

  18. Calculating a Thermodynamic Score (continued) • Develop 2 models based on a given target strand: 5’ AA AGTCACCGTCAAGGTGTATTT 3’ 3’ TTTCAGTGGCAGTTCCACATAAA 5’ The 2 models will represent the sense and the antisense of the siRNA. • The first model combines the first 5 nucleotides of the 5’ end of the sense with the last 5 nucleotides of the 3’ end of the antisense and incorporates a 3’ dangling nucleotide from the antisense. The second model repeats this process for the 5’ end of the antisense and 3’ end of the sense. Given the above example” • SENSE: • 5’ AGUCA3’ • 3’U UCAGU5’ • ANTISENSE • 5’ AUACA3’ • 3’UUAUGU5’

  19. Calculating a Thermodynamic Score (continued) • SENSE: • 5’ AGUCA3’ • 3’U UCAGU5’ • ANTISENSE • 5’ AUACA3’ • 3’UUAUGU5’ • The thermodynamic score of the 4 nearest neighbors (based on Watson-Crick Nearest Neighbor method) are added to the thermodynamic score of the Dangling 3’ overhang. • SENSE: AG =-2.08, GU =-2.24, UC=-2.35, CA=-2.11, _A = -.10 • (-2.08) + (-2.24) + (-2.35) + (-2.11) + (-0.1) = -8.88 • ANTISENSE: AU=-1.10, UA =-1.33, AC=-2.24, CA=-2.11, _A = -.10 • (-1.10) + (-1.13) + (-2.24) + (-2.11) + (-0.1) = -6.88 • Thermodynamic Score is the difference of the energy of the 5’ sense and the 5’ antisense. • -8.88 – (-6.88) = -2.00

  20. Demonstration • Web-based siRNA Design Tool

  21. Acknowledgements • Dr Muhammand A Rahman – Assistant Professor, University of West Georgia • Bingbing Yuan – MIT, Whitehead Biocomputing Group • Michael Duong – McMaster University

More Related