PLANT Biotechnology (Part-1)
851 likes | 2.19k Vues
PLANT Biotechnology (Part-1). Nono Carsono Suseno Amien Anas Agrotechnology. Competency. Understand application of biotechnology for plant science/plant breeding, including: DNA isolation and cloning Tissue culture (overview) Molecular marker technique (overview)
PLANT Biotechnology (Part-1)
E N D
Presentation Transcript
PLANT Biotechnology(Part-1) Nono Carsono Suseno Amien Anas Agrotechnology
Competency • Understand application of biotechnology for plant science/plant breeding, including: • DNA isolation and cloning • Tissue culture (overview) • Molecular marker technique (overview) • Transfer gene techniques (transgenic plants) • Current application: examples of transgenic plants with improved traits
Content • Overview Biotech product- plant based, etc • Tissue culture for crop improvement (overview) • Marker assisted selection (marka bantu seleksi) • Transgenic plant: some examples • Genetic transformation (Gene transfer)- 2nd lecture • Regulatory principles of transgenic plants
Concept Map Transgenic plant Variety improvement Conventional breeding New developed tools (complement for ) In vitro culture Molecular marker Transfer gene (transgenic) Selection Hybridization Mutation Plant Biotech
Uses of Plant Biotech in a Breeding Program • Source of Genetic Variation • The Ultimate Driving Force Behind All New Technologies • To Speed Variety Development • Faster Source for Genetic Variation • Faster, more Efficient Assimilation of Traits • High Through-put Screening • To Improve Quality • Purity/Hybridity Testing
How Old Is Biotechnology ? 10,000 BC Domesticating Crops 6,000 BC Brewing Beer Domesticating Animals 8,000-9,000 BC 4,000 BC Leavening Bread 1940’s Production of Antibiotics 1880’s Production of Vaccines 1980’s Use of genetically modified organisms
World’s Food Supply vs. Increasing Population ? Green Revolution Chemical Agriculture Mendel
What are the new products of plant biotechnology? • Herbicide tolerant crops, e.g., Roundup Ready soybeans and corn and Liberty Link corn • Insect resistant crops commercially available, e.g., Bt corn, cotton, and potatoes • Corn rootworm resistance
What are the new products of agricultural/plant biotechnology? • Herbicide tolerant crops, e.g., Roundup Ready soybeans and corn and Liberty Link corn
What are the next products of rice biotechnology? Golden Rice Wild type Engineered to produce more vitamin A precursor, beta-carotene In Southeast Asia, 70% of children under the age of five suffer from vitamin A deficiency
: an overview 30,000 30,000 metabolite
Chemical Enzymatic Mechanic • SDS, sarcosyl • CTAB • Proteinase K • Lysozyme • Freezing • Sonication • Grinding Cell lysis • Phenol • chloroform • Sodium chloride • Sodium acetate • Membrane • Beads Organic solvents Salt DNA binding Protein removal Alcohol • Ethanol • Iso-propanol DNA precipitation DNA isolation – the basic concept Process Common procedure
Cloning - a definition • Production of multiple identical copies of gene-carrying DNA
How is DNA cloned? Cell-based DNA cloning Cell-free DNA cloning (PCR)
Why Clone DNA? • A particular gene can be isolated and its nucleotide sequence determined • Control sequences of DNA can be identified & analyzed • Protein/enzyme/RNA function can be investigated • Mutations can be identified, e.g. gene defects related to specific diseases • Organisms can be ‘engineered’ for specific purposes, e.g. insulin production, insect resistance, etc.
Steps in DNA cloning • DNA extraction- target gene isolation (PCR, probe) • Cutting DNA with Endonucleases (cutting-optional) • Join DNA with Ligases (ligation) • DNA entry into cell (competence cells; transformation) • Identifying recombinants from non-transformants (screening)- blue-white screening, white: true transformant (true plasmid recombinant)
Isolation of cloning vector (bacterial plasmid) & gene-source DNA (gene of interest) ---DNA extraction Insertion of gene-source DNA into the cloning vector using the same restriction enzyme; bind the fragmented DNA with DNA ligase –cutting & ligation Introduction of cloning vector into cells (transformation by bacterial cells) – transformation (insertion of vector into host cell by heat shock) Cloning of cells (and foreign genes) Identification of cell clones carrying the gene of interest How to clone DNA
The medium in this petri dish contains the antibiotic Kanamycin The bacteria on the right contain Kanr, a plasmid that is resistant to Kanamycin, while the one on the left has no resistance Note the difference in growth Screening of the clone
lacZ insert functional enzyme nonfunctional enzyme X-gal product X-gal product Blue/White Color Screening lacZ
Tissue Culture Applications (overview) • Micropropagation • Germplasm preservation • Somaclonal variation & mutation selection • Embryo Culture • Haploid & Dihaploid Production • In vitro hybridization – Protoplast Fusion • Industrial Products from Cell Cultures
Micropropagation Tahap III Tahap I Tahap II Tahap IV
What are molecular markers? • Genetic information resides in the genome • A molecular marker is based on DNA sequence • Polymorphisms arise by mutation (polymorphism: occurrence of two or more alleles at a locus in a population) …gtataagtgaaccactcagggtcctggccgggcacagtggctcacgcctgtaatcccagcctttgggaggccgaggtgggtggatcatgaggtcaggagttcaagaccagcctggccaaatggcgaaacattgtctctactaaaagtacaaaaattagccagacgtggtggtgctcactgtaatcccagctactcgggaggctgaggcaggaaaatcacttgaacccgggaggcggaggtcacagttagccaagatcacaccactgtactccag … ATP5L2 ATP synthase C22orf11 chromosome 22 ORF PANX2 pannexin 2
DNA Fingerprinting Basics Different individuals carry different alleles. Most alleles useful for DNA fingerprinting differ on the basis of the number of repetitive DNA sequences they contain.
Ideal attributes of molecular markers Co-dominant (distinguish between homozygotes and heterozygotes) Nondestructive assay Complete penetrance High polymorphism Random distribution throughout the genome Assay can be automated
Phenotypic markers 2-rowed 6-rowed Black white hulled naked non-waxy waxy
Conversion of a phenotypic marker to a molecular marker non-waxy waxy
Methods for marker development Restriction digest Polymerase chain reaction (PCR)
DNA Fingerprinting Basics Restriction Digest If DNA is cut…(by what ?), DNA fragments of different sizes will be produced. A DNA fingerprint is made by analyzing the sizes of DNA fragments produced from a number of different sites in the genome that vary in length. The more common the length variation at a particular site and the greater the number the sites analyzed, the more informative the fingerprint.
A Site With Three Alleles Useful for DNA Fingerprinting DNA fragments of different size will be produced by a restriction enzyme that cuts at the points
The DNA Fragments Are Separated on the Basis of Size The technique is gel electrophoresis. The pattern of DNA bands is compared between each sample loaded on the gel.
Possible Patterns for a Single “Gene” With Three Alleles In a standard DNA fingerprint, about a dozen sites are analyzed, with each site having many possible alleles.
Polymerase Chain Reaction (PCR) - a method for amplifying (copying) small amount of DNA, starting with a small initial quantity. - an in vitro or cell-free method for synthesizing DNA. - it was invented in 1985 by Kary Mullis (received the Nobel Prize for chemistry in 1993).
PCR- components & steps • Generated by using Polymerase Chain Reaction • Preferred markers due to technical simplicity and cost PCR Buffer + MgCl2 + dNTPS + DNA template Primers + Taq + PCR THERMAL CYCLING Polyacrylamide Agarose GEL ELECTROPHORESIS Agarose or Acrylamide gels
Components of PCR • Template DNA (DNA cetakan, umumnyaberupagenomik DNA) • primers (sequence DNA ± 10-30 nucleotida, sbgnucleotidaygmengawalireaksi polymerase/pemanjangan DNA sequence) • dNTPs (dATP, dTTP, dCTP & dGTP) sbgsumbersubstrat A,C, G, T. • MgCl2 (membantuenzim polymerase berfungsidenganbaik) • PCR buffer, pH 8 (menjagareaksi polymerase stabil) • Taq DNA polymerase (enzimygmengkatalisreaksi polymerase/pembentukanrantai DNA)
PCR • Three major phases in PCR: • Denaturing (94ºC): Double strand DNA menjadi single strand DNA • Annealing (55º-59ºC): penempelanantara primer dengan target sequence • Extension (72ºC): sintesisrantai DNA (polymerase atau elongation)
Question 1. What for Plant Breeder use biotechnology 2. What are the new products of agricultural biotechnology use Plant Biotechnology ? 3. What does the term cloning mean? 4. What is gene cloning? How does it differ from cloning an entire organism? 5. Why is gene cloning done? 6. How is gene cloning accomplished ? 7. What are some of the ethical considerations regarding gene cloning?
References Kreuzer, H., Massey, A.,2001, Recombinant DNA & Biotechnology, ASM Press, Washington Turner, P.C., et al, 1997, Instant Notes n MolecularBiology, Bios, Oxford www.agbiosafety.unl.edu/education/clone.htm http://avery.rutgers.edu/WSSP/StudentScholars/Session12/Session12html http://www.pssc.ttu.edu/pss3421/gene%20cloning%20Strategies.htm http://www.uic.edu/classes/phar/phar331/lecture7 http://www.biology.arizona.edu