TA Cloning Test of ZeBaTA-Based Agrobacterium tumefaciens Binary Vector
Ligation of XcmI-digested pCXUN alone yielded very few colonies, while ligation with PCR product yielded a large number of colonies. Transformation into E. coli DH10B by electroporation resulted in the generation of T-vectors. Samples of randomly selected colonies were analyzed through restriction digestion, showing the expected results. The single-step PCR generation of an amiRNA construct for gene silencing in rice was successfully achieved. Predicted secondary structures of the mutated osa-MIR528 stemloop were generated using mfold. This method holds promise for efficient cloning and gene silencing experiments in plants.
TA Cloning Test of ZeBaTA-Based Agrobacterium tumefaciens Binary Vector
E N D
Presentation Transcript
A (2) (1) B M 5 1 3 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2 4 6 Supplemental Figure S2. TA cloning test of ZeBaTA-based Agrobacterium tumefaciens binary vector. A, TA cloning test of binary vector pCXUN. (1) Ligation of XcmI-digested pCXUN alone yielded very few colonis; (2) Ligation of XcmI-digested pCXUN with PCR product yielded a large number of colonies. The ligations were carried out in a total volume of 10 μL mixture containing 50 ng of T-vector alone, or with the corresponding volume of PCR product of a rice blast fungus Magnaporth oryzea gene MGG_00194.5 with a standard insert-to-vector molar ratio around 6:1. The ligation reaction mixture was transformed into E. coli strain DH 10B by electroporation. B, Samples of restriction digestion analysis of the randomly selected colonies derived from ligation of XcmI-digested pCXUN with PCR product of MGG_00194.5. All samples (Lanes 1-20) digested by BamHI released one band as expected.
rice miRNA precursor osa-MIR528, figure modified from Warthmann et al., (2008) Vectors pXUN-osaMIR528 and pCXUN-osaMIR528 Ubquitin promoter * * G C C G TGTATGG ACATACC ccdB gene CCATACA GGTATGT XcmI XcmI Tnos Generation of T-vectors by XcmI digestion Ubquitin promoter G C C G Tnos Introduce the amiRNA/amiRNA* by single-step PCR P1 AAAGAGCGAACATGGTCGACCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTGTCGAGCATCTTCGCTCTTTA ATTTCTCGCTTGTACCAGCTGGTCCTCTAAGTCAAACTTCGACCTGAAGTGAAAACGGAGAGACAGCTCGTAGAAGCGAGAAA OsPDS-amiRNA* OsPDS-amiRNA P2 Making plant expression amiRNA construct by TA cloning Ubquitin promoter AAAGAGCGAACATGGTCGACCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTGTCGAGCATCTTCGCTCTTTA ATTTCTCGCTTGTACCAGCTGGTCCTCTAAGTCAAACTTCGACCTGAAGTGAAAACGGAGAGACAGCTCGTAGAAGCGAGAAA G C C G OsPDS-amiRNA* OsPDS-amiRNA Tnos Supplemental Figure S3. Schematic representation of single-step PCR generation of an amiRNA construct for gene silencing in rice. Vectors pXUN-osaMIR528 and pCXUN-osaMIR528 were designed based on a rice miRNA precursor osa-MIR528. A G-to-C and a C-to-G mutations (marked with an asterisk) were introduced to generate the XcmI recognition sites. amiRNA and amiRNA* can be introduced into the osa-MIR528 backbone by single step PCR using the primers containing amiRNA/amiRNA* sequence. The system was evaluated by expression of amiRNA for silencing of PDS gene in rice.
A B Supplemental Figure S4. Predicted Secondary Structure of the Mutated osa-MIR528 stemloop. A, Structure of the original osa-MIR528 stemloop. Structure of the mutated osa-MIR528 stemloop. The secondary structures were predicted using mfold (http://www.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi). The nucleotides marked in the open boxes are the positions where mutations were made to introduce two XcmI recognition sites.