heathwalker
Uploaded by
59 SLIDES
619 VUES
590LIKES

Gil Ast

DESCRIPTION

Explore the intricate world of human molecular genetics, from gene expression to DNA structure, and delve into diseases like Duchenne Muscular Dystrophy and Fragile X syndrome. Unravel the mysteries of DNA, chromosomes, epigenetics, and genetic mutations impacting human health.

1 / 59

Télécharger la présentation

Gil Ast

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Gil Ast Dep. of Human Molecular Genetics and Biochemistry Room 1009, 10th floor Tel: 6893 640

  2. Sylabus The Cell by B. Alberts http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Books Essential Cell Biology by Alberts

  3. Genetics Science of genes Molecular Biology Gene expression

  4. Embryonic stem cells Day 1 Day 2-3 Day 4 Day 5 Day 6-9 Day 14

  5. Each cell in our body contains the same genetic information (DNA) Gene - encodes for protein nucleus

  6. The pathway of gene expression

  7. A nucleotide H deoxy

  8. The sugar of RNA and DNA RNA DNA

  9. The base bind position 1 O

  10. The bases

  11. single strand DNA ssDNA

  12. ssDNA • 5’-to-3’ • Phosphodiester bond • 2) direction • 3) 5’ end • 3’end • 4) upstream and • downstream

  13. How to describe DNA GAACCTGAGACCTACTGGTCCG

  14. Base-paring

  15. dsDNA Base pair = bp Double strand DNA = dsDNA Anti-paralel

  16. dsDNA • Anti-parallel • Complementary strand 3.ladder 4. Each basepair is called 1bp

  17. A:TandG:C A = 10-10

  18. Gene – a DNA region that is transcribed to RNA, and the RNA with a biological function Gene 3

  19. Intron – a region in the DNA that is transcribed but removed from the mRNA precursor and is not part of the mature mRNA Exons – part of the mature mRNA Introns are found only in eukaryotes

  20. Human genome 2.91 billion base pairs 24,000 protein coding genes (~32,000 non-coding genes) 1.5% exons (127 nucleotides) 24% introns (~3,000 nucleotides) 75% intergenic (no genes) Average size of a gene is 27,894 bases Contains an average of 8.8 exons Titin contains 234 exons.

  21. We humans are 99.9% identical at the DNA sequence level • There are still ~3 million nucleotide differences among us called SNPs (60,000 within the exons)---that presumably account for differences in disease susceptibility, drug responses, etc. • Polymorphic variation between and within populations • Implications for concepts of “race,” “individuality”

  22. 24,000

  23. Duchenne Muscular Dystrophy MOLECULAR BIOLOGY OF THE DISEASE Duchenne Muscular Dystrophy is one of more than twenty different types of muscular dystrophy. The Duchenne type affects only boys and is known to result from a defect in a single important protein in muscle fibers called Dystrophin. The muscle fiber will break down if the Dystrophin is missing and is unable to function properly. As a result, the reduction in the number of good muscle fibers and the whole muscle becomes weak.

  24. Summary • DNA, Chromosome • Centromere, telomere, replication origin • Nucleosome, Chromatin, • Histone: H1, H2A, H2B, H3, H4 • Histone octamer, DNA packaging • DNA binding proteins, Histone modifications

  25. Histone proteins

  26. HDAC HDAC activity HAT

  27. מבנה הנוקלאוזום סיכת ביטחון

  28. H2A H2B H3 H4

  29. Covalent Modification of core histone tails Acetylation of lysines (K) Mythylation of lysines Phosphorylation of serines (S) Histone acetyl transferase (HAT) Histone deacetylase (HDAC) epigenetics Acetylation Mythylation

  30. Species Species Fruit fly 8 Corn 20 Planaria 16 Algae 20 Frog 26 Potato 48 Cat 38 Mouse 40 Macaque 42 Yeast 32 Human 46 Penicillin mold 4 Total number of chromosomes/somatic (body) cell There is no connection between the number of chromosomes and the genome size, gene content, or any other feature of genomes. It is and essentially independent characteristic. Dog 78

  31. Cockayne syndrome group B (CSB) cells that fail to express CSB protein which causes profound neurological and developmental defects Blue – DNA White - gene

  32. Chromosomal fragile sites are loci that are especially prone to forming gaps or breaks on metaphase chromosomes when cells are cultured under conditions that inhibit DNA replication or repair. The relationship of "rare" folate sensitive fragile sites with (CCG)n expansion and, in some cases, genetic disease is well established.

  33. Fragile X syndrome What is Fragile X syndrome?Fragile X syndrome is the most common inherited cause of mental impairment, affecting approximately 1 in 2,000 males and 1 in 4,000 females worldwide. Cytogenetic analysis of metaphase spreads demonstrates the presence of the fragile site in less than 60% of cells in most affected individuals.). In 1991, the fragile X gene (FMR1) was characterized and found to contain a tandem repeated trinucleotide sequence (CGG) near its 5' end. The mutation responsible for fragile X syndrome involves expansion of this repeat segment. The number of CGG repeats in the FMR1 genes of the normal population varies from six to approximately 50. There are two main categories of mutation, premutations of approximately 50 to 200 repeats and full mutations of more than approximately 200 repeats. There is no clear boundary between the upper limit of normal and the lower limit of the premutation range. For this reason, alleles with approximately 45-55 copies of the repeat are said to be in the "grey zone." Some alleles in this size range are unstable and expand from generation to generation, while others are stably inherited. A premutation is susceptible to expansion after passage through a female meiosis. The larger the size of a woman's premutation, the more the risk of expansion to a full mutation in her offspring. .

  34. In man 104 to 105 sites a replication rate of 2 kb/minute

  35. Origins of replication • In E. coli only one site OriC • In man 104 to 105 sites • The direction of replication is bi-directional OriC OriC OriC

  36. The problem – DNA ends! If this shoelace were a chromosome,then these two protective tips would be its Telomeres

  37. The solution: adding repetitive sequences to the ends CHROMOSOME TELOMERE 3’ TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 5’ AATCCCAATCCC

More Related