1 / 43

Thomas R. Insel, M.D. Director, NIMH

Rethinking Mental Illness: How Research Will Change Practice. October 22, 2008. Thomas R. Insel, M.D. Director, NIMH. 500. ~ 1,329,000 Projected Deaths in 2000. 400. 300. Deaths per 100,000. 200. ~ 514,000 Actual Deaths in 2000. 100. 95. 50. 55. 60. 65. 70. 75. 80. 85. 90.

herne
Télécharger la présentation

Thomas R. Insel, M.D. Director, NIMH

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Rethinking Mental Illness: How Research Will Change Practice October 22, 2008 Thomas R. Insel, M.D. Director, NIMH

  2. 500 ~ 1,329,000 Projected Deaths in 2000 400 300 Deaths per 100,000 200 ~ 514,000 Actual Deaths in 2000 100 95 50 55 60 65 70 75 80 85 90 00 Year Impact of Research on Heart Disease • 63% decrease in mortality • ~ 1 million early deaths averted per year • $2.6 trillion in economic return • New, effective treatments and prevention strategies

  3. Number of Survivors 9 6 Millions of People 3 1971 1986 1990 2003 Impact of Research on Cancer • For the first time in recorded history, annual cancer deaths in the United States have fallen • 10 million survivors

  4. Impact of Research on Mental Illness • Diagnosis is by observation, detection is late, prediction is poor. • Etiology is unknown; prevention is empirical and not well-developed for most disorders. • Treatment is trial and error – no cures, no vaccines. Bottom line: Prevalence has not decreased for any illness. Mortality has not decreased for any illness.

  5. Burden of Disease (DALYs) U.S., Canada, and Western Europe 15-44 years old Source: WHO World Health Report 2002

  6. Burden of Disease by Specific Illness – DALYsUnited States, Canada, and Western Europe15-44 years old Source: WHO World Health Report 2002

  7. Mental Illnesses:Why the high morbidity? Prevalent (6% U.S. - serious) Disabling (largest population on SSI, SSDI) Chronic disorders of young people

  8. Mental Disorders: Mortality • Over 30,000 suicides per year (in the U.S.) • - 90% related to mental illness • For context: • 18,000 homicides • 20,000 AIDS deaths • only 3 forms of cancer > 30,000

  9. Public Health Impact:Early Mortality in Individuals with Major Mental Illness (MMI) • Data from outpatient • and inpatient clients • diagnosed with MMI • Average age at time • of death : 56 years • Increased likelihood • of dying from suicide • Decreased likelihood • of dying from cancer Adapted from Colton and Manderscheid, 2006, Prev Chronic Dis

  10. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Mental disorders result from complex genetic risk plus experiential factors. Current treatments may be necessary but not sufficient for recovery.

  11. DepressionRecovery Cg25 Prefrontal 9 Cg25 Affect in Subgenual Cingulate (BA25) Depressed Affect increased CBF/Met’b Cg25 decreased CBF/Met’b Prefrontal 9 Cg25 R Mayberg et al. Am J Psych 156:675-82 1999

  12. Is Cg25 change necessary for antidepressant efficacy? Cg25 F9 pCg31 Fluoxetine Responders hc hc Cg25 Cg25 p Non- Responders pCg31 F9 F9 hc hc Mayberg, 2006

  13. PF MCC MF PCC MCC CBT MEDS PF P PCC Meds Cg25 BS Defining Depression Circuits Response Pathways Cognition (attention-appraisal-action) hc Par40 PM6 PF9/46 Mood state thal mF9/10 na-vst Self-awareness insight pACC24 amg mb-vta oF11 Salience Motivation sACC25 a-ins hth bstem Interoception (drive-autonomic-circadian) Br Med Bul 65:193-207, 2003 Arch Gen Psych 61:34-41-2004

  14. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Mental disorders result from complex genetic risk plus experiential factors. Current treatments may be necessary but not sufficient for recovery.

  15. Developmental Regression in the Brain Source: J Giedd, NIMH

  16. Schizophrenia as a Developmental Disorder

  17. Possible Paths to Schizophrenia Psychosis Threshold Intervention A Developmental Brain Model for Schizophrenia Normal Development # of Cortical Synapses 10 15 20 25 Age Based on McGlashan and Hoffman (2000)

  18. Schizophrenia: A Developmental Brain Disorder Genetic risk Unusual thought content Suspicion/paranoia Social impairment History of substance abuse 68-80% prediction Arch Gen Psych, 2008

  19. Progressive Brain Structural Changes Mapped as Psychosis Develops in “At Risk” Individuals Sun et al, Schiz Res., 2008

  20. 2020 2008 1988 Schizophrenia Trajectory Stage 1: Presymptomatic, Risk factors, Cognitive deficit with challenge [< Age 15] Stage 2: Prodrome, cognitive deficits emerging, minor disability [Age 15 – 18] Stage 3: Psychosis, acute disability, family costs [Age 18 – 24] Stage 4: Chronic illness, medical complications, social costs [> Age 24]

  21. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Mental disorders result from complex genetic risk plus experiential factors. Current treatments may be necessary but not sufficient for recovery.

  22. Human HapMap Project (2005) Mapped all the common variations in the human genome …CTAGGCTTAAGCGTACCTGCTCTAGCTCAGTC…. 3 million common Single Nucleotide Polymorphism (SNP) Structural Variations in the Genome (2007) …CTAGGCTTAGGCTTAGGCTTAGGCTTAAGCG GACCTGCTCTAGGTCAGTC…. The Genomics Revolution Human Genome Project (2003) Mapped 3 billion bases of DNA in human genome …CTAGGCTTAAGCGGACCTGCTCTAGGTCAGTC….

  23. 2007 second quarter 2007 third quarter 2007 fourth quarter 2005 2007 first quarter First quarter 2008 2006 Second quarter 2008 Manolio, Brooks, Collins, J Clin Invest 2008; 118:1590-625.

  24. Phenotype? Autism Genes: What do we know from association studies? • CNTNAP2 • Neuroligins/Neurexins • Shank3 • Wnt2 • GABA-B3 • SLC25A12 (mit asp/glut carrier) • MET (7q31)

  25. Autism as a Synaptic Disorder AJHG 2008

  26. Genomes Vary in Structure as well as Sequence From Scherer et al, Nature 2007

  27. Pathways to Pathophysiology Meyer-Lindenberg & Weinberger, Nature Rev Neurosci, 2007

  28. Disruptive Innovations In Mental Health Mental disorders are brain disorders. Mental disorders are developmental disorders. Mental disorders result from complex genetic risk plus experiential factors. Current treatments may be necessary but not sufficient for recovery.

  29. Current Treatments: How Good? 10,000 patients, 200 sites, 3 diseases, practical trials CATIE (chronic schiz) Real world setting Recovery of function Practical questions STAR*D (MDD) STEP-BD (Bipolar)

  30. Current Treatments: How Good? • Schizophrenia: 74% discontinuation of anti-psychotics, limited access to psychosocial Rxs • Depression: 31% remitted at 14 weeks, 67% at 1 year, limited access to CBT • Bipolar: 21% stable for 8 weeks in first 6 months, high rates of medical co-morbidity • Childhood disorders: dx prevalence increase 10-fold for autism, 40-fold for bipolar, no selective meds and few proven behavioral approaches

  31. Practical Trials – What Did We Learn? • We can optimize care in real world settings • With optimized care, outcomes are not optimal • Current treatments help too few people get better and very few get well

  32. NIMH Mission To transform the understanding and treatment of mental illnesses through basic and clinical research, paving the way for prevention, recovery, and cure.

  33. NIMH Strategic Plan • Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders • Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene • Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness • Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research

  34. NIMH Strategic Plan • Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders Genes to circuits to behavior cycle Genomics and epigenomics Developmental neuroscience

  35. NIMH Strategic Plan Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene Predictive biosignatures Longitudinal designs Individual risk

  36. NIMH Strategic Plan Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness Rational therapeutics Preemptive and personalized interventions Moderator trials

  37. NIMH Strategic Plan Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research Participatory research Impact on practice Health disparities

  38. NIMH Strategic Plan • Strategic Objective #1: Promote Discovery in the Brain and Behavioral Sciences to Fuel Research on the Causes of Mental Disorders • Strategic Objective #2: Chart Mental Illness Trajectories to Determine When, Where and How to Intervene • Strategic Objective #3: Develop New and Better Interventions for Mental Disorders that Incorporate the Diverse Needs and Circumstances of People with Mental Illness • Strategic Objective #4: Strengthen the Public Health Impact of NIMH-Supported Research

  39. But Professor Einstein, these are the same questions you used on last year’s exam? Yes, but this year the answers are completely different.

  40. Paving the Way for Prevention, Recovery, and Cure www.nimh.nih.gov

  41. Then (1998) Diagnosis: Unitary RESEARCH Mechanism: Chemical imbalance Treatment: First generation Imagine (2018) Diagnosis: Dimensional Mechanism: Genes to behavior Treatment: Personal & pre-emptive Now (2008) Diagnosis: Categorical but co-morbid Mechanism: Brain circuit dysfunction Treatment: Second generation

More Related