holt
Uploaded by
29 SLIDES
501 VUES
310LIKES

Major Histocompatibility Complex Project II

DESCRIPTION

Major Histocompatibility Complex Project II. by Aramak Afzal Ezzeddin Kamil Fatemeh Kaveh Hawlader Abdullah Al-Mamun. Introduction.

1 / 29

Télécharger la présentation

Major Histocompatibility Complex Project II

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Major Histocompatibility ComplexProject II by Aramak Afzal Ezzeddin Kamil Fatemeh Kaveh Hawlader Abdullah Al-Mamun

  2. Introduction • The Major Histocompatibility Complex (MHC) is a large genomic region or gene family found in most vertebrates containing many genes with important immune system roles. • Three types of MHC: Class I, Class II and Class III • Class II MHC molecules are associated with many autoimmune diseases.

  3. Immune System • The immune system is the system of specialized cells and organs that protect an organism from outside biological influences. • it protects the body against bacteria and viral infections, destroying cancer cells and foreign substances • Two types of immune system: Innate Immunity and Adaptive Immunity

  4. Immune System continued… • Innate Immunity:generally comprising a set of germ-line encoded receptors to pathogens, that does not change during the lifetime of the organism • Adaptive Immunity: The provision of long lasting and specific protection against formerly encountered pathogens, which takes days to develop • The MHC molecules belongs to adaptive immune system.

  5. Location of MHC in Human Genome

  6. Class I, II and III MHC • MHC is encoded by several genes on chromosome 6. • The class I region encodes class I molecules that perform antigen-presenting function to CD8 T-lymphocytes, • The class II region encodes the class II molecules that present antigen to CD4 T-lymphocytes. • The class III region harbors a diverse array of structurally unrelated genes, among them several genes involved in innate immunity.

  7. Class I MHC • Class I molecules are composed of two polypeptide chains; one encoded by the BCA region and another (ß2-microglobulin) that is encoded elsewhere. • The MHC-encoded polypeptide is about 350 amino acids long and total molecular weight of about 45 kDa • This polypeptide folds into three separate domains called alpha-1, alpha-2 and alpha-3. • ß2-microglobulin is a 12 kDa polypeptide that is non-covalently associated with the alpha-3 domain.

  8. Class I MHC • Class I MHC Side view Top view

  9. Class II MHC • Class II molecules are composed of two polypeptide chains, both encoded by the D region. • These polypeptides (alpha and beta) are about 230 and 240 amino acids long, and molecular weights of about 33 kDa and 28 kDa. • These polypeptides fold into two separate domains; alpha-1 and alpha-2 for the alpha polypeptide, and beta-1 and beta-2 for the beta polypeptide.

  10. Class II MHC • Class II MHC Side view Top view

  11. Basic Features of MHC • The MHC is associated with more diseases than any other region of the human genome. • It is the most polymorphic region in the genome. • the best known genes in the MHC region are the subset that encodes cell-surface antigen-presenting proteins. In humans, these genes are referred to as human leukocyte antigen (HLA) genes

  12. Basic Features of MHC continued… • The most intensely studied HLA genes are the nine so-called classical MHC genes: HLA-A, HLA-B, HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, and HLA-DRB1. • In humans, the A, B, and C genes belong to MHC class I while the six D genes belong to class II

  13. Origin of MHC • Origin not known • Class II first or Class I first? • Hypothesis 1: Class I MHC originated first as a result of a recombination between an immunoglobulin-like C-domain and the peptide-binding domain of an HSP70 heat-shock protein. • Hypothesis 2: the ancestral MHC molecule had a class II-like structure and it gave rise to the class I molecule. second hypothesis is supported by more evidence. • One research suggest MHC region may be as old as 370 million years. • MHC is not present in all invertebrates as well as primitive vertebrates. • MHC seems to evolved from the primitive jawed vertebrates and upwards.

  14. Species That Have MHC Genes

  15. BoLA: The MHC of cattle is found on the chromosome 23 • OLA: The MHC of sheep OLA has been localized to chromosome 20 between bands q15-q23 • Chicken MHC is located on microcromosome 16 and it is called the B-F/B-L region • H-2/RT1: Chromosome 20p12 encompasses the MHC of mouse/rat.

  16. comparative analysis of structure and sequence of the MHC region in mouse H2 (top), rat RT1 (center), and human HLA (bottom).

  17. MHC Related Databases IPD The Immune Polymorphism Database (IPD) is a set of specialist databases related to the study of polymorphic genes in the immune system. The IMGT/HLA Sequence Database The IMGT/HLA Sequence Database provides a specialist databases for sequences of the human major histocompatibility complex (HLA) and includes the official sequences for the WHO HLA Nomenclature Committee for Factors of the HLA System. The IMGT/HLA Sequence Database is part of the international ImMunoGeneTics project (IMGT).

  18. PART II DISTRIBUTED ANNOTATION SERVER

  19. Definition : “The distributed annotation system (DAS) is a client-server system in which a single client integrates information from multiple servers. It allows a single machine to gather up genome annotation information from multiple distant web sites, collate the information, and display it to the user in a single view. Little coordination is needed among the various information providers” (biodas.org).

  20. DAS Specification • Distributed Annotation System (DAS); • A server system for the sharing of Reference Sequences, and their annotations. • Reference Sequence; • A sequence. • Annotation - An entity which: • Is anchored to the reference sequence via a stop and start value. • Possesses an ID unique to the server and a structured description of its types, methods, and categories. • Global Annotation: • Annotation that applies to the entire reference sequence; start and stop are void

  21. DAS client DAS server DAS server DAS server remote storage remote storage remote storage Distributed Annotation System (DAS) genome browser www.biodas.org local storage reference sequence XML

  22. HTTP query example : (to retrieve all the data sources in a databases) http://servlet.sanger.ac.uk:8080/das/dsn <?xml version='1.0' standalone='no' ?> <!DOCTYPE DASDSN SYSTEM 'dasdsn.dtd' > <DASDSN> ... <DSN> <SOURCE id="ensembl_Fugu_rubripes_core_28_2d" version="28_2d">pufferfish ensembl 28_2d</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Fugu_rubripes_core_28_2d/</MAPMASTER> <DESCRIPTION>ensembl pufferfish Curation Reference Source</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Homo_sapiens_core_32_35e" version="32_35e">human ensembl 32_35e</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/</MAPMASTER> <DESCRIPTION>ensembl human Curation Reference Source</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Homo_sapiens_core_32_35e_cds" version="32_35e">ensembl cds</SOURCE> <MAPMASTER>http://das.ensembl.org/das/ensembl_Homo_sapiens_core_32_35e</MAPMASTER> <DESCRIPTION>Clone centric view of ensembl human CDS</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Mus_musculus_core_28_33d" version="28_33d">mouse ensembl 28_33d</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Mus_musculus_core_28_33d/</MAPMASTER> <DESCRIPTION>ensembl mouse Curation Reference Source</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Saccharomyces_cerevisiae_core_29_1" version="29_1">yeast ensembl 29_1</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Saccharomyces_cerevisiae_core_29_1/</MAPMASTER> <DESCRIPTION>ensembl yeast Curation Reference Source</DESCRIPTION> </DSN> ... </DASDSN>

  23. HTTP query example : (to retrieve the list of sequence entry points available and their sizes in base pairs)http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/entry_points/ <?xml version='1.0' standalone='no' ?> <!DOCTYPE DASEP SYSTEM 'dasep.dtd' > <DASEP> <ENTRY_POINTS href="http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e /entry_points/" version="32_35e"> ... <SEGMENT id="15_NT_079547" size="168820" subparts="yes" /> <SEGMENT id="8_NT_079523" size="13036" subparts="yes" /> <SEGMENT id="17" size="78774742" subparts="yes" /> <SEGMENT id="6" size="170975699" subparts="yes" /> <SEGMENT id="7_NT_086714" size="182896" subparts="yes" /> <SEGMENT id="17_NT_079570" size="31181" subparts="yes" /> <SEGMENT id="17_NT_079556" size="142595" subparts="yes" /> <SEGMENT id="8_NT_079517" size="50950" subparts="yes" /> <SEGMENT id="DR52" size="170972699" subparts="yes" /> <SEGMENT id="21" size="46944323" subparts="yes" /> ... </ENTRY_POINTS> </DASEP>

  24. HTTP query example : (to retrieve the annotations across one or more segments of sequence)http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ features?segment=6:31400000,31500000 <?xml version='1.0' standalone='no' ?> <!DOCTYPE DASGFF SYSTEM 'dasgff.dtd' > <DASGFF> <GFF version="1.0" href="http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ features?segment=6:31400000,31500000"> <SEGMENT id="6" version="32_35e" start="31400000" stop="31500000"> ... <FEATURE id="AL645933.8.2001.111328" label="AL645933.8.2001.111328"> <TYPE id="contig" reference="yes" subparts="no">contig</TYPE> <METHOD id="ensembl">ensembl</METHOD> <START>31460758</START> <END>31570085</END> <SCORE>-</SCORE> <ORIENTATION>+</ORIENTATION> <PHASE>-</PHASE> <TARGET id="AL645933.8.2001.111328" start="1" stop="109328" /> </FEATURE> <FEATURE id="ENST00000359635" label="HLA-B"> <TYPE id="transcript">transcript</TYPE> <METHOD id="ensembl">ensembl</METHOD> <START>31430239</START> <END>31432935</END> <SCORE>-</SCORE> <ORIENTATION>-</ORIENTATION> <PHASE>-</PHASE> </FEATURE> ... </SEGMENT> </GFF> </DASGFF>

  25. HTTP query example : (to retrieve DNA corresponding to the indicated segment)http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ dna?segment=6:31430239,31432935 <?xml version='1.0' standalone='no' ?> <!DOCTYPE DASDNA SYSTEM 'dasdna.dtd' > <DASDNA> <SEQUENCE id="6" version="32_35e" start="31430239" stop="31432935"> <DNA length="2697"> tcaagctgtgagagacacatcagagccctgggcactgtcgctgcctggagtagaacaaaaacaggacctggtcagagcccgcaggagacgtgggacaggaggaattatggggtgggtgagctcctccacactcccacccccaccacttacacgcagcctgagagtagctccctccttttccacctgtgggaagaaaatgtcctgtgagggcactgggaggaagcagggccatgagatcttagaggaacctcctagtcttggacccaaaaggaatttccagaagtatgactacagacccagggcaggatcaggaaacacgaggaaagcaagtgtgggtcctggaccaactgccctcctaaggtctgtccttagcagggaccttcccctgactcatgaatgctggaatcaggaccccaacaccacaaccatcaaggtgatacatccatccttcattgtcacatgtgctgcacaaaagagtaagtgctggcacacagggtcccaggctgcgttagcccctgtgtgcatgctgcttcccagtaatgaggcagggaacacttctacctggggcttgaaacccccagtgggacaagaaaacccagaccccacccctcaccccttccctacctgaactcttcctcctacacatcacagcagcgaccacagctccgatgaccacaactgctaggacagccaggccagcaacaatgcccacgatggggacggtggactgggaagacggctctgggaaaggaggggaagatgaggggccctgaccctgctgaagggctcctgctttccctgagaagagatatgacccctcatccccctccttaccccatctcagggtgaggggcttcggcagcccctcatgctgtacatggcatgtgtatctctgctcttctccagaaggcaccaccacagctgcccacttctggaaggttctatctcctgctggtctggtctccacaagctcagtgtcctgagtttggtcctcgccatcccgctgccaggtcagtgtgatctccgcagggtagaaacccagggcccagcacctcagggtggcctcatggtcagagatggggtggtgggtcacgtgtgtctttggggggtctgatgggaagagtcagaaaattcaggcgctttgcatctttcatgggacaccctaggaccacccatgtgaccagcctgagaatggacaggacacctggggtggggaaggggcacagaacccagacaccagcctggacgcaggcacctgggataatctcctattcattggaaagttcgagtctctgagcggggaacagggacttctgctcctgatctgagtggaggtaaagtgactcagaagtgctggaatcagagccccaaacacactgagtgtgaggcagagaacaaggcctgagaggaaaagtcacggttcccaaggctgctgcaggggtcaaaggggacccctgatcagtattctagggactgtcttcccctccatttcctcagagacgtcattccttaattgtctagagagaagagggggccctcagaggaaactcaggaaaactcatgccattctccattcaacggagggcgacattctagcgctgatcccattttcctcctcttctcgtgggaggccatccccggcgacctataggagatggggaaggctccccactgcccctggtaccagcgcgctccagcttgtccttcccgttctccaggtatctgcggagccactccacgcactcgccctccaggtaggctctccgctgctccgcctcacgggccgcctcccacttgcgctgggtgatctgagccgccgtgtccgcggcggtccaggagcgcaggtcctcgttcagggcgatgtaatccttgccgtcgtaggcgtactggtcatgcccgcggaggaggcgcccgtccggccccacgtcgcagccgtacatgctctggagggtgtgagaccctggccccggccccgcggtcagcccagtcccccgagccccgccccgccccgaccaacccgcggggattttggcctcaactgaaaatgaaaccgggtaaacgcgcctggggctctcgccggtcgagggtctgggcgggtcccgcggcctcagggaggcggatctcggacccggagactcggggcgacccgggccgtacgtgggggatggggagtcgtgacctgcgccccgggccggggtcactcaccggcctcgctctggttgtagtagccgcgcaggttccgcaggctctctcggtcagtctgtgcctgggccttgtagatctgtgtgttccggtcccaatactccggcccctcctgctctatccacggcgcccgcggctcctctctcggactcgcggcgtcgctgtcgaacctcacgaactgggtgtcgtccacgtagcccactgagatgaagcggggctccccgcggccgggccgggacacggaggtgtagaaatacctcatggagtgggagcctgggggtgaggaggggctgagacccgcccgaccctcctcccggcgcggctcctcaggtcctgcgcccccgcctgcggtcccctcgctcctcccggcagaggccatttccctcccgacccgcactcaccggcccaggtctcggtcagggccagggccgccgagagcagcaggaggacggttcggggcgccatgaccagcatctcggcgtctgaggagactct </DNA> </SEQUENCE> </DASDNA>

More Related