Practice Base-Paring
E N D
Presentation Transcript
Review • Original strand: ATTCCG • Complement: • Original strand: GCTAAG • Complementary strand: • Original strand: CTACCA • Complement: • Original: • Strand A: GACCTA • Strand B: • What is the purpose of replication? • How does DNA serve as its own template?
RNA Transcription & Protein Synthesis From DNA to Proteins 2 Types of nucleic acid
DNA- Life’s Code DNA -> RNA -> Protein
Central Dogma DNA RNA Protein Transcription DNA RNA Translation RNA Protein
RNA and Protein Synthesis • Why make proteins? • Skin, muscles, nails, hair, hormones, enzymes • How do we make proteins?
DNA makes RNA • RNA is the 2nd type of Nucleic Acid • RNAis made of nucleotides, just like DNA • 1. Riboseis the sugar • 2. Phosphate • 3. Nitrogen Bases • Adenine (A) • Guanine (G) • Cytosine (C) • Uracil (U): NOT Thymine (T) • Single Stranded • When RNA is assembled based off of DNA’s pattern, this is called Transcription
RNA and Protein Synthesis Types: • mRNA – messenger • tRNA – transfer • rRNA - ribosomal
RNA and Protein Synthesis Comparing DNA and RNA Deoxyribose Ribose A T C G A U C G Double Helix Single Stranded Nucleus. Cytoplasm, Ribosomes Nucleus
DNA Transcription DNA is too large to get out of the nucleus, RNA carries DNA’s message out of the nucleus to a ribosome. Ribosome – where the protein will be made. • Occursin the nucleus • DNA is again unzipped, this timebyRNA Polymerase. • Reversibly breaks Hydrogen bonds • RNA Polymeraseadds complementary RNA nucleotides • Starting at a region called the promoter • Ending at a terminator region • This makes mRNA = messenger = carries the message • mRNAleavesthe nucleus
3 Stages of Transcription • Write on bottom of your notes… • 1. Initiation: RNA polymerase binds to the DNA at the promoterregion. • 2. Elongation: RNA polymerase moves along the coding strand of DNA, adding complementary RNA nucleotides, building the RNA transcript • 3. Termination: RNA polymerase reaches the terminator region of the DNA and is released, DNA re-coils
P Deoxy-ribose Transcription Deoxy-ribose ---H--- Adenine P P P P P P P P P P P P mRNA exits nucleus Strands move apart RNA Polymerase makes mRNA RNA Polymerase breaks H-bonds DNA re-coils Ribose Ribose Deoxy-ribose Ribose Deoxy-ribose Ribose Deoxy-ribose Ribose Ribose Thymine Adenine Guanine Uracil Cytosine Guanine Guanine Adenine Adenine Uracil ---H--- P Deoxy-ribose Thymine ---H---
RNA complimentary base pairingduring Transcription • DNA strand = AATTTGCGCGGCT • mRNA strand = • DNA strand = TATGCGCACTG • mRNA strand = • DNA strand = CGATCAGCCTAT • mRNA strand =
Transcription: RNA Editing • Many RNA molecules require a bit of editing before they leave the nucleus. • Introns- not involved in coding for proteins • These get taken out in a process called splicing • Exons- are expressed
Replication vs Transcription • Given the DNA chain below, make the complementary DNA strand and the mRNA strand that would be transcribed: • GGGCGTATTTAGCTAGACCCGAAACCC • Answer the following questions: • What is the purpose of DNA replication? Of Transcription? • What is the final product of DNA replication? Of Transcription? Be Specific. • What is the name of the enzymes(s) used in DNA replication? In transcription? • Where does DNA replication occur in the cell? Transcription?
Translation • RNAtoProtein • All 3 RNA work together to create a protein molecule • Occurs at ribosomes (rRNA), tRNA act as carriers for Amino Acids • Translation: sequence of mRNA is translated into the amino acid sequence of a protein (Polypeptides) • String of amino acids held together by a peptide bond • Sequence of mRNA nucleotides is broken into a series of codons,or a sequence of three nucleotides that codes for an amino acid. • Examples: • AUG=Methionine • CUU=Leucine
The Genetic Code • The genetic code translatesthe mRNA codon into an Amino Acid • AUG= Start/Methionine • UAA, UGA or UAG= Stop • Codon GCA = • Codon AAG = • Codon CGA =
Translation Overview • mRNAcarriesthe DNA instructionsfor making protein • mRNA enters the cytoplasm through nuclear pores • mRNA attaches to aribosome (rRNA)to be “read” • Amino Acids are strung together (using tRNA) as ribosome “reads” mRNA to build a polypeptide chain • Ribosome reaches stop codon and detaches from mRNA • Same 3 steps as transcription • Initiation • Elongation • Termination
Initiation • Ribosome binds its P site to mRNA at start codon (AUG) • Ribosome made of 3 sites: • E site: tRNA prepares to exit after dropping off Amino Acid • P site: newly arriving Amino Acid joins • A site: next in line to be added
Elongation • Transfer RNA (tRNA) carrying Amino Acids enter ribosome • tRNA is complementary to mRNA • Anticodon: complementary codon on tRNA • mRNA codon: ACC • tRNA anti-codon: • mRNA codon: GUC • tRNA anticodon: • Each tRNA is specific for 1 Amino Acid
Elongation • After start codon, tRNA with the anticodonmatching the next mRNA codon enters A site • Methionine and new Amino Acid form a peptide bond • tRNA carrying Met enters E site, new tRNA enters P site • Original tRNA leaves, new tRNA enters A site • This continues, adding Amino Acids to a growing polypeptide chain • Amino Acids Arrive at A site • Amino Acids bond at P site • Amino Acids Exit at E site
Termination • Elongation continues until a stop codon is reached • Stop codon does not have a matching tRNA • Polypeptide chain ends, ribosome, mRNA and polypeptide chain split
Translation Mechanism MET This process continues until a stop codon is reached, at which point the mRNA strand, tRNA units, and rRNA subunits are all released. MET ISO PRO tRNA U A C tRNA U A U tRNA U A C tRNA G GG tRNA U A U Start Codon (Methionine) Large Ribosomal Subunit (rRNA) E Site A Site P Site mRNA A A U U G G U U A A U U G G U U A G A A G G A A A A C C C C U U C C U A G U C C A A A A U U A A G G Small Ribosomal Subunit (rRNA)
ribosome mRNA • Process: Codon: 3 nucleotides of mRNA AntiCodon: 3 nucleotides of tRNA U G C G A U C A G A A. A. C tRNA G C A. A. U A G U A. A. C Amino Acid
Process of assembling polypeptides from information encoded in mRNA; Interpreting the code! • Number the 4 anti- codons in the order they occur • TRANSLATION
1. Which two mRNA codes correspond to histidine? 2. How many different mRNA codes correspond to arginine?
Protein Synthesis Summary
Review • What are the three parts to the Central Dogma? • How is RNA similar to DNA? • How is RNA different from DNA? • What are the 3 types of RNA? • Recall: How do amino acids differ from each other? • What are the bonds that hold together the amino acids?
Mutations • Mutations can happen in two locations: • Sex cells: affect the offspring • Body cells: affect the individualonly • Mutations can have one of three affects: • Those that cause a disease • Those that are beneficial • Silent mutations: do not cause disease – most common • Mutations can be one of two types: • Point mutations: affecting single nucleotide • Chromosomal mutations: affect section of or whole chromosome
Causes of Mutations • Mistakes in base paring during DNA Replication • DNA Polymerase can usually detect such errors • When missed, may cause many genetic disorders • Chemicals: like tobacco • Can lead to cancer because it changes the genes that regulate mitosis • Radiation: includingUV (sun) andX-ray • Can lead to cancer because it changes the genes that regulate mitosis
Point Mutations • 1. Substitution • One nitrogen base issubstitutedfor another • Sickle Cell Anemia: substitute A for T
Point Mutations • 2. Deletions and insertions • When a nitrogen base is deletedoradded • Causes a Frame shift mutations- because it moves the codon up or down • Changes the sequence of amino acids
Mutation Expression • Silent: no change in original sequence of proteins. May occur from change in base that does not change codon, or to a codon that codes for the same Amino Acid • Missense: change in one DNA base pair that results in the substitution of one amino acid for another • Nonsense: change in on DNA base pair that results in premature stop codon • Rather than coding for an Amino Acid, the stop codon ends the production of the polypeptide chain • results in a shortened protein that may function improperly or not at all. • Most ______________ outcome.