1 / 19

Cell Surface Targeting

Cell Surface Targeting. 7/24/06. Adaptamers. Questions. Can we observe a gel shift with the conditions we’re using? If so, are our aptamers binding protein?. Answers. Yes, we can observe streptavidin binding biotin.

ishmael-zamora
Télécharger la présentation

Cell Surface Targeting

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Cell Surface Targeting 7/24/06

  2. Adaptamers

  3. Questions • Can we observe a gel shift with the conditions we’re using? • If so, are our aptamers binding protein?

  4. Answers • Yes, we can observe streptavidin binding biotin. • No, neither of our aptamers appear to bind their targets. But we’re pretty sure of the reason.

  5. (Very) High Concentrations T5: thrombin aptamer + 5 nts S5: streptavidin aptamer + 5 nts Protein staining DNA staining Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin

  6. Findings 1) Observation of streptavidin binding biotin. Protein staining DNA staining Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin

  7. Findings • Observation of streptavidin binding biotin. • Streptavidin is not binding S5. Protein staining DNA staining Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin

  8. Findings • Observation of streptavidin binding biotin. • Streptavidin is not binding S5. • BSA is actually responsible for bands in lanes with thrombin. Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin

  9. Findings • Observation of streptavidin binding biotin. • Streptavidin is not binding S5. • BSA is actually responsible for bands in lanes with thrombin. • Is there a thrombin shift? Unclear. Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin

  10. Moderate Concentration 4) Thrombin shift? No. Protein staining DNA staining Protein staining 2: thrombin 3: thrombin + T5 4: streptavidin + S5 5: streptavidin + S5 6: streptavidin + biotinylated oligos DNA staining 8: nothing + loading dye 9: T5 10: T5 + thrombin 11: S5 12: S5 + streptavidin

  11. Moderate Concentration Question: What is responsible for these bands? Protein staining DNA staining Protein staining 2: thrombin 3: thrombin + T5 4: streptavidin + S5 5: streptavidin + S5 6: streptavidin + biotinylated oligos DNA staining 8: nothing + loading dye 9: T5 10: T5 + thrombin 11: S5 12: S5 + streptavidin

  12. More answers • Have been using bovine thrombin, not human thrombin. • Secondary structure issues: everyone else denatures their aptamers prior to incubation with protein

  13. Next: • Change the thrombin, add denaturation • If it works, • try adaptamer experiments; also, redesign adaptamers to avoid secondary structure conflicts. • Order aptamers that can bind a cell. • If it doesn’t, • Put on thinking cap.

  14. Sequencing results • Clones from Ting lab: StrepW, StrepH, StrepD • BioBrick’d and sent out for sequencing last week • Results • StrepW: Correct sequence 1-444 from both forward/reverse reactions • StrepH: One mutation at bp 344, T to C • GCT to GCC, silent mutation for alanine • StrepD: Correct sequence 1-409 from forward reaction, correct sequence 410-444 from reverse reaction • Performed midipreps

  15. OmpA PCR Lpp PCR XbaI/PstI digest 1650 full 1000 500 500 400 46-159 400 OmpA 46-159 300 300 500 full full +stop 200 200 400 1-29 46-66 100 300 100 Lpp 1-29 OmpA 46-66 200 100 BioBricks for Lpp-OmpA

  16. StrepSCDF StrepSCDMF E X 825 1 S P StrepSCDMR StrepSCDR PstI site, 620 CTGCAG CTGCGG 1st PCR Crossover PCR 1000 F/R non-mut 850 F/MR 650 400 500 300 F/R 400 MF/R 300 SCD-NM C2 E2 200 100 SCD-NM C2 E2 BioBricks for SCD streptavidin • Single-chain dimer clones from Aslan lab • SCD-NM • C2 • E2 sent out for sequencing

  17. Sequencing results • Homology in bp regions ~1-250 and ~550-800 • Why? • Single • Chain • Dimer • Forward primer annealing region • Bp 004-023: gaggccaacgccaagaagtc • Bp 538-557: gaggccaacgcctggaagtc • Explains double PCR products with F/MR and F/R primers • Does not explain single crossover PCR product

  18. Progress/plans • Midipreps of StrepW, StrepH, StrepD • BioBricks of Lpp(1-29), OmpA(46-66) and (46-159); sent out for sequencing • Confirm sequences of Lpp and OmpA parts; midiprep. • Digest and assembly. • Figure out solution for StrepSCD PCR • Design new primers • Anneal upstream on plasmid • PCR in separate parts and assemble

More Related