jack-wood
Uploaded by
44 SLIDES
567 VUES
440LIKES

Overview of Microbial Genetics: DNA Replication and Gene Expression Mechanisms

DESCRIPTION

This lecture provides a comprehensive overview of microbial genetics, focusing on DNA replication and gene expression. It details the structure of bacterial chromosomes, the role of plasmids, and the characteristics of nucleic acids. Key processes in DNA replication, including initiation, elongation, and termination, are discussed, alongside the central dogma of molecular biology (DNA → RNA → Protein). The mechanisms of transcription and translation are outlined, highlighting the roles of mRNA, ribosomes, and tRNA. Understanding these foundational concepts is crucial for studying microbial genetics.

1 / 44

Télécharger la présentation

Overview of Microbial Genetics: DNA Replication and Gene Expression Mechanisms

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Lecture 6 Microbial Genetics: DNA Replication Gene Expression

  2. Genetics • Genome= • Cells genome organized into chromosomes • Chromosome= • Gene= segment of the DNA that codes for one protein

  3. Bacterial Chromosome • Single circular chromosome composed of DNA • Looped and folded and attached at one or more points to the plasma membrane • Supercoiled

  4. Bacterial Plasmids • Many prokaryotic cells also contain plasmids • They replicate independently from the chromosome

  5. Nucleic Acids 2 types of nucleic acids: Deoxyribonucleic acid (DNA) Ribonucleic acid (RNA) Subunit: Nucleotides

  6. Nucleotide

  7. Nitrogen containing bases 5 Different: Purines: Adenine (A) Guanine (G) Pyrimadines: Thyamine (T) Cystosine (C) Uracil (U)

  8. Synthesis of DNA Dehydration synthesis- forming of covalent bonds between nucleotides Forms between phosphate group of one nucleotide and sugar of another nucleotide Phosphate joins #3 carbon of one sugar with #5 carbon of the other Results in backbone of alternating sugar and phosphate molecules

  9. Double Helix of DNA Strand are held together by hydrogen bonds A pairs with T G pairs with C # of A= # of T # of G=# of C DNA sequence: read from 5’ to 3’ Sequence example: ATTAGCA etc.

  10. DNA Replication

  11. DNA Replication • Purpose is to create new DNA strand, so that upon binary fission, each of the 2 cells receives a complete copy of DNA • Bidirectional- from distinct starting point- proceeds in both directions • Semi- conservative- each of the 2 DNA helix’s generated contains 1 new strand and 1 old strand

  12. First Stage: Initiation • DNA unwinds and strands separate • As the DNA unzips, two replication forks form and move in opposite directions away from the origin

  13. Second Stage: Elongation • Enzymes synthesize a new stand to pair with each original strand • Nucleotides can only be added in 3’ to 5’ direction • This creates leading and lagging strands • The lagging strand is synthesized in Okazaki fragments, which are joined by DNA ligase

  14. Figure 8.4

  15. Third Stage: Termination • Two DNA helices separate from each other • Each chromosome now contains one old and one new strand

  16. Figure 8.5

  17. Figure 8.6b

  18. Gene Expression: Transcription Translation

  19. Central Dogma of Molecular Biology • DNA  RNA  Protein • Gene Expression: The production of a protein product from a gene • Involves two steps: transcription and translation

  20. Gene Expression • Series of two processes that link genes to proteins • Transcription: synthesis of RNA from DNA • Translation: synthesis of protein from RNA

  21. Transcription • DNA used as template • Use one strand of DNA to make mRNA molecule • mRNA is complementary to one strand of DNA

  22. Initiation of Transcription • Transcription begins when RNA polymerase recognizes and binds to sequence of nucleotides in the DNA called the promoter • The promoter orients the RNA polymerase in one of two possible directions, telling it which DNA strand to use

  23. Transcription- Elongation • RNA polymerase moves along template strand of DNA, synthesizing the complementary single-stranded RNA molecule • RNA synthesized in 5’ to 3’ direction, nucleotides added to 3’ end • Very fast: 30 nucleotides per second

  24. Transcription- Termination • When RNA polymerase encounters terminator it falls off DNA • Once terminated RNA is called mRNA

  25. Figure 8.7 (Overview) (1 of 7)

  26. mRNA • Messenger RNA • Temporary copy of genetic information • 3 nucleotides of DNA  3 nucleotides of RNA • 3 nucleotides of RNA is a codon • One codon codes for one amino acid • String of amino acids with proper 3-D shape  protein

  27. Translation • Process by which information on mRNA is decoded to synthesize the specified protein • Proteins synthesized by adding amino acids sequentially • Remember: one codon  one amino acid • How many amino acids would one protein contain if it was translated from an mRNA that is 690 nucleotides long?

  28. AUGCGGCAGACCAAACGAUUGGUUGCGUAA • How many codons? 10 • List the codons: AUG CGG CAG ACC AAA CGA UUG GUU GCG UAA

  29. The Genetic Code: Universal for all living things

  30. Translation • Process of translation requires three major components • mRNA • Ribosomes • tRNA

  31. Ribosomes • Serve as sites of translation, or sites of protein synthesis • Prokaryotic ribosomes are 70S • Large subunit- 50S • Small subunit- 30S

  32. tRNA • Transfer RNA • Carries amino acids to the ribosome • Recognize and base-pair with a specific codon and deliver appropriate amino acid to site • Recognition occurs because each tRNA has an anti-codon, which is complementary to codon on mRNA

  33. Initiation of Translation • Translation begins as the mRNA is still being synthesized • 30S subunit binds to ribosome-binding site • tRNA and 50S subunit soon join • AUG- start codon- codes for methionine

  34. Elongation • Ribosome moves along mRNA • As the next codon is exposed, a new tRNA with correct anti-codon moves in • As each tRNA brings in the correct amino acid it forms a covalent bond to it’s neighboring amino acid • Elongation continues until stop codon is reached

  35. Regulation of Gene Expression • Protein synthesis requires a huge amount of energy • Regulation of protein synthesis conserves energy for the cell • Repression and Induction • Operon model of gene expression

  36. Repression and Induction • Repression: inhibits gene expression and decreases the synthesis of enzymes • Mediated by regulatory proteins called repressors • Induction: process that turns on the transcription of a gene • Mediated by regulatory proteins called inducers

  37. Operon model of gene expression • Read over Operon Model of Gene Expression before class (page 229-231) • Work in groups to understand the concept

More Related