520 likes | 720 Vues
DNA/GENE TECHNOLOGY. Chapter 9. DNA fingerprinting. The promise and perhaps perils of embryonic stem cells. Types of Genetic Engineering. Selective Breeding GMO’s Gene Sequencing Gene Cloning/Pharmaceutical Production DNA Fingerprinting Transgenic Organisms
E N D
DNA/GENE TECHNOLOGY Chapter 9
DNA fingerprinting The promise and perhaps perils of embryonic stem cells Types of Genetic Engineering • Selective Breeding • GMO’s • Gene Sequencing • Gene Cloning/Pharmaceutical Production • DNA Fingerprinting • Transgenic Organisms • Therapeutic Cloning/Stem Cells • Reproductive Cloning • Gene Therapy • Human Genome Project
Engineering vs. Technology • Genetic Engineering • The process and outcome of making changes in the DNA code of living organisms • Genetic Technology • The tools and instruments used and developed for the process of manipulating genes
Selective breeding • Produces organisms with desired traits • 2 Types – Inbreeding & Hybrids • What traits might breeders want to select for in these organisms?
Inbreeding • Mating of closely related individuals • Ensures that offspring remain homozygous for most traits • Keeps wanted traits in the breed • Keeps out un-wanted traits Pure-Bred (inbred) Bulldog Inbred Weimeraner Dog
Inbreeding • Does have a high risk of offspring receiving 2 HARMFUL recessive alleles that were present in the family line • Which means??? • Causes mutations that ALREADY exist to pair at a higher frequency
Hybrids • Usually produce larger, stronger organisms • AND VARIATION! • Mixing dominant & recessive keeps out harmful recessive phenotypes • ESPECIALLY IN PLANTS!
HybridsDogs and Ligers and Geep – oh my! Hybridization – Mating of slightly dissimilar organisms to produce desired combination Must have same chromosome number, similar structure Liger Geep – Hybrid of Goat and Sheep
Genetically Modified Organisms: GMOs • Altering the genetics of plants or animals for human benefit • One of the first was Bt cotton: • Bacterial gene from Bacillus thuringiensis was put in cotton • Made it toxic to insects • Specifically the Boll Weevil GMO Cotton (contains a bacterial gene for pest resistance); 80% of all cotton Standard Cotton
Genetically Modified OrganismsGMOs • Altering the genetics of plants and animals for human consumption • Polyploidy – chemicals disrupt meiosis – bigger fruit or seedless fruit
Fourteen month-old genetically engineered (GMO) salmon (left) and standard salmon (right). Genetically Modified OrganismsGMOs
Transgenic organisms • Organisms with genes from other species • Ex: Mice with jellyfish gene – will glow!!! • Benefits of transgenics: • Gene function determination • Medical studies, drug trials • Creation of medical proteins/drugs • Hybrid organisms/GMO’s • EX: Human chemotherapy drug in chickens
Transgenic vs. Clone Transgenic Organisms have genes inserted from another organism Cloned Organisms have the exact same DNA as another organism Tobacco Plant with firefly gene Dolly the cloned sheep
Types of cloning • Gene cloning • Inserting just one gene into org to copy • Therapeutic cloning • Stem cells new cells/organs • Reproductive cloning • Creating an entire organism
Therapeutic Cloning/Stem Cells • Stem cells – undifferentiated cells • Can develop into any type of cell in body • Embryonic* – most potential for success • But regulated by law • Bone marrow/Spinal – some potential for success
Possible clone use… • Cloning new stem cells to repair tissues
Stem Cells are Found in the Adult, but the Most Promising Types of Stem Cells for Therapy are Embryonic Stem Cells
Therapeutic Cloning/Stem Cells Therapeutic cloning- cloning of specific cells/tissues/organs; not whole organism
Some Thorny Ethical Questions Are these masses of cells a human? Is it ethical to harvest embryonic stem cells from the “extra” embryos created during in vitro fertilization?
Gene Cloning • Cloning a single GENE in an organism… • Organism copies gene through replication • Produces proteins
Reproductive Cloning • Making an identical organisms genetically speaking • Steps: • 1. Take DNA (nucleus) from existing org. • 2. Take egg cell and replace its nucleus (DNA) with existing org. DNA (nucleus) • 3. Allow egg cell to develop into offspring • 4. Offspring will have same DNA as existing organism • Why should we clone? • Food industry? • Endangered species? • Problems/Ethics? Dolly I and Dolly II – her clone
(Science (2002) 295:1443) Reproductive Cloning - Pet Cloning? University of Texas 2002 – Success Rate of 1/87 embryos Significantly, Carbon Copy is not a phenotypic “carbon copy” of the animal she was cloned from Environmental factors and proteome interactions cause phenotypic differences Nature vs. Nurture argument FYI – cost $ 3.7 million
Possible clone use… • Clone successful plants
Gene Therapy • Vectors-carry DNA from one source to another. Useful in gene therapy and making recombinant DNA • A virus is often used • Knock out the viral DNA and add desired gene to ‘infect’ patient
Gene Therapy • Restriction enzymes cut out ‘normal’ gene from genome sample • Take out viral DNA and add ‘normal’ human gene to virus • Viral vector infects patient with ‘normal’ gene to replace mutated one • Normal gene inserts into patient’s DNA and now produces proper protein/trait • Ex: normal CF gene being infected into a cystic fibrosis patient
Creating Recombinant DNA 1. Cut (cleave) DNA from one organism with a restriction enzyme 2. Insert (splice) the wanted genes (DNA) from another organism (Fig 13.4) • RESULT: • RECOMBINANT DNA = TRANSGENIC ORGANISM • Usually done on plasmid DNA = (bacterial) circular DNA
What if there isn’t enough DNA in the sample? • Tiny amounts of DNA can be amplified by a technique called PCR (polymerase chain reaction)
PCRMaking enough DNA to read • Three – step amplification cycle • Cycles of heating and cooling • Causes DNA to separate (DENATURE) and then come back together (ANNEAL) • Use DNA Polymerase • Generates MORE DNA a certain size of DNA fragment (from one sample) PCR
Now that we have enough DNA… What’s next?
CUTTING DNARestriction Enzyme We will use TA-ase, an imaginary enyzme, to cut our DNA Sample DNA strand CTGGCTAGGCTACCATGCCCGTAAAT Restriction Enzymes
CUTTING THE DNARestriction Enzyme We will use TA-ase, an imaginary enyzme, to cut our DNA Sample DNA strand CTGGCTAGGCTACCATGCCCGTAAAT CTGGCTA GGCTA CCATGCCCGTA AAT
SEPARATING THE DNAGel Electrophoresis Electricity separates fragments by size in a gel Largest fragment travels least Smallest the most Gel Electrophoresis
Here are our DNA fragments Which one will travel fast and far? WHY? Which one will travel slow and short? WHY? CTGGCTA GGCTA CCATGCCCGTA AAT 1 3 4 2
SEPARATING THE DNAGel Electrophoresis CCATGCCCGTA CTGGCTA GGCTA AAT
SEPARATING THE DNA Gel ElectrophoresisRESULTS…DNA “Fingerprint” • Can be used to ID persons • Very effective means of: • Criminal identification & exclusion • Paternity cases • Missing persons • Entire DNA is not used, only portions known to differ from individual to individual • Gel is sometimes called an “autoradiograph” or “autorad” M = Marker (control) DNA
DNA FINGERPRINT:THE LAB BASICS (A SUMMARY) • PCR = to increase the amount of DNA • Restriction enzymes = to cut the DNA into different sized fragments • Gel Electrophoresis = to separate fragments according to size • CONCLUSION = Try to match fragments from different samples
STEP 4 = READINGHow do you read a DNA fingerprint? Victim’s DNA finger print
STEP 4 = READINGHow do you read a DNA fingerprint? A B C D E Victim’s DNA finger print Which sample is a match?,
STEP 4 = READINGHow do you read a DNA fingerprint? A B C D E Victim’s DNA finger print Which sample is a match?,
STEP 4 = READINGHow do you read a DNA fingerprint? C Victim’s DNA finger print Which sample is a match?,
ANALYZING DNA SAMPLES • Let’s try some…
DNA FINGERPRINTING • Comparing different samples of DNA
Paternity Testing • Not just matching evidence to suspect…
Gene Sequencing – How do we know what a gene does? • Gene cloning (in a bacterium) protein synthesis analysis of amino acid sequence • Gene “knockout” in “lab” animals • Comparative sequences in people with disease/without
Gene Sequencing – How do we know what the DNA is? • Take gene cut by restriction enzymes • Put gene into bacteria/rat to see what protein does • Use florescent DNA probes to bind to complementary sequences • Ex: Glowing ACT DNA probe would attach to TGA DNA & id that sequence