jermaine-conrad
Uploaded by
2 SLIDES
213 VUES
20LIKES

Supplementary Table 1

DESCRIPTION

Supplementary Table 1 Primers of polymerase chain reaction (PCR) in the corresponding genes tested in Fig. 3. Gene name s. Gene codes. Forward primers (5'>3'). Reverse primers (5'>3'). Length s (bp). Cycles. 24. APS1. A t5g48300. GAAAAACCAAAAGGGGAG. TCAGTCCAAGGGAAGTG. 214. 24.

1 / 2

Télécharger la présentation

Supplementary Table 1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Supplementary Table 1 Primers of polymerase chain reaction (PCR) in the corresponding genes tested in Fig. 3. Gene names Gene codes Forward primers(5'>3') Reverse primers(5'>3') Lengths (bp) Cycles 24 APS1 At5g48300 GAAAAACCAAAAGGGGAG TCAGTCCAAGGGAAGTG 214 24 APL1 At5g19220 TCCCCACAGCAAACGACTT TGGCAGGTTTCTCCTTG 209 28 APL4 At2g21590 AGATAGGCCAGAGGAAG GGGAAAGAAAAGATCGAAG 190 28 GBSS1 At1g32900 ATGTTCTCGGTGGTCTAC ACCTTTGCATTCATGTAG 249 28 SS2 TGTAGCTGGTGCTTTAC AGAAATCATCTACCGGTC 485 At3g01180 28 At1g11720 SS3 TGTCTTATTAGGTTCAG TGCAGAGTGATAGAGC 487 28 SBE3 At2g36390 AGTTTCAATGAAGATCTC GAGGCAGATGAAGAGC 179 30 ISA1 TATGCATCTGAAGCTTC TCAACTCCTCTAAATGAG 447 At2g39930 28 At1g10760 GWD1 TGGGAACGTAAGGGTAAAC TCTGGTTGCTTGGAAAC 218 At4g17090 30 BAM3 ATGTGGAGGAAACGTAG ACTCGCTATTCCATGTTC 497 At5g24780 24 VSP1 ACGTCCAGTCTTCGGCATC GTGTTCTCGGTCCCATATC 385 22 ACT2 At3g18780 ACCTTGCTGGACGTGACCTTACTGAT GTTGTCTCGTGGATTCCAGCAGCTT 298 Supplementary Table 1 Title: Enhancement of starch accumulation in plants by exogenously applied methyl jasmonate Authors: Takahashi I, Hara M Journal:Plant Biotechnology Reports

  2. 15 * * 10 (mg g-1 fresh weight) Starch content 5 0 0 100 250 500 1000 JA concentration (μM) Supplementary Figure 1 Effect of jasmonic acid (JA) on starch accumulation in Arabidopsis leaves. Arabidopsis (ecotype Columbia) plants were grown in 7-cm plastic pots filled with Peatban (Sakata Seed, Yokohama, Japan) in growth chambers with 100 μmol m-2 s-1 light under long-day conditions (16 h light/8 h dark cycle) at 23 ℃. The density of planting was three plants per pot. (±)-JA (Cayman Chemical, MI, USA) was dissolved in ethanol at the concentrations of 0 (ethanol only), 100, 250, 500, and 1000 mM, respectively. Ten micro liters of the corresponding JA solutions were added to water (9.99 mL). The resulted solutions (0, 100, 250, 500, and 1000 μM JA) were used for the JA application. The JA solutions were sprayed on the surface of the leaves of three-weeks-old plants with a hand-pump aerosol spray bottle (1 mL per pot) at the start of the light period. At the subsequent end of the light period, the rosette leaves were harvested and used for the following starch analysis. Fresh tissues were treated twice with 10 volumes of 80% (v/v) ethanol at 80 ℃ for 20 min. The ethanol insoluble residue was extracted by an equal volume of 0.4 M KOH at 80 ℃ for 60 min. After the extract was neutralized, soluble starch was digested by 10 U α-amylase and 7 U amyloglucosidase. Glucose formation was determined by a glucose oxidase- and peroxidase-based enzyme assay. Starch content was calculated based on the released glucose. Values and bars represent means ± SD (n = 5). *Significant difference (p < 0.05) in comparison to control (0 μM JA) determined by Student’s t-test. Title: Enhancement of starch accumulation in plants by exogenously applied methyl jasmonate Authors: Takahashi I, Hara M Journal: Plant Biotechnology Reports

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer