josie
Uploaded by
3 SLIDES
215 VUES
30LIKES

1 KB+

DESCRIPTION

Supplementary Figure S1. Southern blot analyses of TLP events selected for targeting. Genomic DNA digested with EcoR1 and probed with ELP (left) and pat (right ) sequences. . ELP-2-011. ELP-1-004. ELP-1-007. ELP-2-011. ELP-1-004. ELP-1-007. 1 KB+. 1 KB+. 1 KB+. 1 KB+.

1 / 3

Télécharger la présentation

1 KB+

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Supplementary Figure S1. Southern blot analyses of TLP events selected for targeting. Genomic DNA digested with EcoR1 and probed with ELP (left) and pat (right) sequences. ELP-2-011 ELP-1-004 ELP-1-007 ELP-2-011 ELP-1-004 ELP-1-007 1 KB+ 1 KB+ 1 KB+ 1 KB+

  2. Supplementary Figure S2. qPCR ‘disruption’ assay results. Samples with a target-to-reference ratio above 2.0 are considered to have amplified from events with an intact ELP sequence. Intact ELP Disrupted ELP

  3. Supplementary Figure S3. Junction sequence. Representative sequences from preintegrated ELP and donor DNA junction. Pre-integrated 5’ ELP Sequence Pre-integrated 3’ ELP Sequence Donor Gene Sequence (5’ end) (3’ end) Donor 5’ Homologous Sequence Donor 3’ Homologous Sequence 105941-597 105943-789 tgggtgggatctcagcctca....cactatttaa___ tgcttctagt..... aaacctcctggctacttcaa tgggtgggatctcagcctca....cactatttaa--- tgcttctagt..... aaacctcctggctacttcaa

More Related