30 likes | 191 Vues
Supplementary Figure S1. Southern blot analyses of TLP events selected for targeting. Genomic DNA digested with EcoR1 and probed with ELP (left) and pat (right ) sequences. . ELP-2-011. ELP-1-004. ELP-1-007. ELP-2-011. ELP-1-004. ELP-1-007. 1 KB+. 1 KB+. 1 KB+. 1 KB+.
E N D
Supplementary Figure S1. Southern blot analyses of TLP events selected for targeting. Genomic DNA digested with EcoR1 and probed with ELP (left) and pat (right) sequences. ELP-2-011 ELP-1-004 ELP-1-007 ELP-2-011 ELP-1-004 ELP-1-007 1 KB+ 1 KB+ 1 KB+ 1 KB+
Supplementary Figure S2. qPCR ‘disruption’ assay results. Samples with a target-to-reference ratio above 2.0 are considered to have amplified from events with an intact ELP sequence. Intact ELP Disrupted ELP
Supplementary Figure S3. Junction sequence. Representative sequences from preintegrated ELP and donor DNA junction. Pre-integrated 5’ ELP Sequence Pre-integrated 3’ ELP Sequence Donor Gene Sequence (5’ end) (3’ end) Donor 5’ Homologous Sequence Donor 3’ Homologous Sequence 105941-597 105943-789 tgggtgggatctcagcctca....cactatttaa___ tgcttctagt..... aaacctcctggctacttcaa tgggtgggatctcagcctca....cactatttaa--- tgcttctagt..... aaacctcctggctacttcaa