Bioinformatics - Gene databases
21 Enero 2010 Dr. Victor Treviño. Bioinformatics - Gene databases. HUGO ( www.genenames.org ) NCBI ( http://www.ncbi.nlm.nih.gov ) EBI – EMBL ( http://www.ebi.ac.uk/ ) EBIMed ( http://www.ebi.ac.uk/Rebholz-srv/ebimed/ ) SwissProt / UniProt http://www.ebi.ac.uk/uniprot/
Bioinformatics - Gene databases
E N D
Presentation Transcript
21 Enero 2010 Dr. Victor Treviño Bioinformatics - Gene databases
HUGO (www.genenames.org) • NCBI (http://www.ncbi.nlm.nih.gov) • EBI– EMBL (http://www.ebi.ac.uk/ ) • EBIMed(http://www.ebi.ac.uk/Rebholz-srv/ebimed/ ) • SwissProt / UniProt • http://www.ebi.ac.uk/uniprot/ • http://www.psc.edu/general/software/packages/swiss/swiss.php • PubGene (http://www.pubgene.org/ ) • GeneCards (http://www.genecards.org/ ) • iHOP (http://www.ihop-net.org/UniPub/iHOP/ ) • Panther (http://www.pantherdb.org/ ) • "Others" Gene Databases(DNA, RNA, Protein)
HUGO – HGNCwww.genenames.org • Human Genome Organization • "OFFICIAL" Gene Names NCBI LINKS
NCBI – Gene Database • Summary • Species (or specific) • Function • Sequence • CDS • Chr Location • Domains • Interactions • GeneRIFs: Gene References Into Function • Lots of LINKS to all parts of NCBI and Externals
NCBI – Nucleotide / Protein GenBank/GenPept Format
Gene Sequence Formats http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml
BLAST - Searching a Gene From Sequence • cgagatgcagatagcagctagagat (at random) • small sequences may identify a gene (dbEST, dbSTS, ePCR)
NCBI - UniGene • Unified Information about A Gene across reported sequences • "set of transcript sequences that appear to come from the same transcription locus (gene or expressed pseudogene), together with information on protein similarities, gene expression, cDNA clone reagents, and genomic location." • VERY IMPORTANT : UniGene ID (Hs. xxxxxx)
On-Line Mendelian Inheritance in Man / Animals Curated "Function" of Genes Good References Strong History / Evidence NCBI – OMIM - OMIA
NCBI – Others… • HomoloGene conserved functions • dbEST snapshot of genes expressed in a given tissue • UniSTS sequence tagged sites, PCR primer pairs, genomic position, genes • SNP Polymorphisms
Ensembl - automatic annotation of large eukaryotic genomes (Genes ID) UniProt - (Universal Protein Resource) is the world's most comprehensive catalogue of information on proteins CiteXplore (good for literature) EBIMed (Tools, semantic mining) EBIhttp://www.ebi.ac.uk/
Uniprot: http://www.uniprot.org/ • Union of Swiss-Prot, TrEMBL, and PIR • Curated: • Swiss-Prot is manually annotated and reviewed. • Good Summaries • References • Sequence • Features (repeats, disulfid, … , domains) • Examples… • Names and origin · Protein attributes · General annotation (Comments) · Ontologies · Alternative products · Sequence annotation (Features) · Sequences · References · Cross-references · Entry information · Relevant documents SwissProthttp://www.ebi.ac.uk/uniprot/
PubGenehttp://www.pubgene.org/ • Good for gene interactions • References • Association to Gene Onthologies (GO) • TEXT-MINING • REALLY NICE
GeneCardshttp://www.genecards.org/ • Good Summary • Function • Lots of links
iHOPhttp://www.ihop-net.org/UniPub/iHOP/ • "Summary" of information for a protein • Linked • TEXT-MINING • REALLY NICE
Pantherhttp://www.pantherdb.org/ • Rich Information • Curated • Pathways • Functions • Families • Homologous
http://bioinformatics.ca/links_directory/ Bioinformatics Links Directory
No SINGLE sitecontains ALL information • wehaveto use severalsources • BioGPS • CURATED data is valuable • Be cautiouswithpredicted data • Relationwithother genes is more difficultto explore Gene databases - summary
http://biogps.gnf.org/ It is a portal of portals You can add as many portal sites as you want Easy to configure Versatile VERY IMPORTANT! BioGPS