1 / 33

EM algorithm and applications

EM algorithm and applications. Relative Entropy. Let p,q be two probability distributions on the same sample space. The relative entropy between p and q is defined by H ( p||q ) = ∑ x p ( x )log[ p ( x )/ q ( x )] = ∑ x p ( x )log(1/( q ( x )) - -∑ x p ( x )log(1/( p ( x )) .

kasie
Télécharger la présentation

EM algorithm and applications

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. EM algorithm and applications

  2. Relative Entropy Let p,q be two probability distributions on the same sample space. The relative entropy between p and q is defined by H(p||q) = ∑x p(x)log[p(x)/q(x)] = ∑x p(x)log(1/(q(x)) - -∑ x p(x)log(1/(p(x)). “The inefficiency of assuming distribution q when the correct distribution is p”.

  3. EM algorithm:approximating MLE from Incomplete Data • Finding MLE parameters: nonlinear optimization problem log P(x| λ) E [log P(x,y|λ)] θ λ λ General idea of EM: Use “current point” θ to construct alternative function Qθ (which is “nice”) if Qθ(λ)>Qθ(θ), than λhas higher likelihood than θ.

  4. The EM algorithm Consider a model where, for observed data x and model parameters θ: p(x|θ)=∑yp(x,y|θ). (y are “hidden data”). The EM algorithm receives x and parameters θ, and returns new parameters *, s.t. p(x|*) > p(x|θ).

  5. The EM algorithm Finding * which maximizes p(x|*)=∑yp(x,y|*). is equivalent to finding * which maximizes the logarithm log p(x|*) = log (∑yp(x,y| *)) Which is what the EM algorithm attempts to do.

  6. The EM algorithm In each iteration the EM algorithm does the following. • (E step): Calculate Qθ() = ∑y p(y|x,θ)log p(x,y|) • (M step): Find* which maximizes Qθ() (Next iteration sets  * and repeats).

  7. Example: Baum-Welsh = EM for HMM The Baum-Welsh algorithm is the EM algorithm for HMM : • E step for HMM: Qθ() = ∑S p(s|x,θ)log p(s,x|), where λ are the new parameters {akl,ek(b)}. (The are the counts of state transitions and symbol emissions in (s,x)).

  8. Baum Welsh = EM for HMM • M step For HMM: Find* which maximizes Qθ(). As we proved, λ* is given by the relative frequencies of the Akl’s and the Ek(b)’s

  9. A simplest example: EM for 2 coin tosses • Given a coin with two possible outcomes: H (head) and T (tail), with probabilities qH, qT= 1- qH. • The coin is tossed twice, but only the 1st outcome, T, is seen. So the data is x = (T,*). • We wish to apply the EM algorithm to get parameters that increase the likelihood of the data. • Let the initial parameters be θ = (qH, qT) = ( ¼, ¾ ).

  10. EM for 2 coin tosses The hidden data which can produce x are the sequences y1= (T,H); y2=(T,T); Hence the likelihood of x with parameters (qH, qT), is p(x| θ) = P(x,y1|) + P(x,y2|) = qHqT+qT2 For the initial parameters θ = ( ¼, ¾ ), we have: p(x| θ) = ¾ * ¼ + ¾ * ¾ = ¾ Note that in this case P(x,yi|) = P(yi|), for i = 1,2. we can always define y so that (x,y) = y (otherwise we set y’(x,y) and replace the “ y ”s by “ y’ ”s).

  11. EM for 2 coin tosses - E step Calculate Qθ() = Qθ(qH,qT). Qθ() = p(y1|x,θ)log p(x,y1|) + p(y2|x,θ)log p(x,y2|) p(y1|x,θ) = p(y1,x|θ)/p(x|θ) = (¾∙ ¼)/ (¾) = ¼ p(y2|x,θ) = p(y2,x|θ)/p(x|θ) = (¾∙ ¾)/ (¾) = ¾ Thus we have Qθ() =¼log p(x,y1|) +¾log p(x,y2|)

  12. EM for 2 coin tosses - E step For a sequence y of coin tosses, let NH(y) be the number of H’s in y, and NT(y) be the number of T’s in y. Then log p(y|) = NH(y) log qH+ NT(y) log qT In our example: y1= (T,H); y2=(T,T), hence: NH(y1) = NT(y1)=1, NH(y2) =0, NT(y2)=2

  13. Example: 2 coin tosses - E step Thus ¼ log p(x,y1|) = ¼ (NH(y1) log qH+ NT(y1) log qT) = ¼ (log qH+ log qT) ¾ log p(x,y2|) = ¾ ( NH(y2) log qH+ NT(y2) log qT) = ¾ (2 log qT) Substituting in the equation for Qθ() : Qθ() =¼log p(x,y1|)+¾log p(x,y2|) = ( ¼ NH(y1)+ ¾ NH(y2))log qH+ ( ¼ NT(y1)+ ¾ NT(y2))log qT NT= 7/4 NH= ¼ Qθ() = NHlog qH + NTlog qT

  14. EM for 2 coin tosses - M step Find * which maximizes Qθ() Qθ() =NHlog qH + NTlog qT = ¼log qH+ 7/4 log qT We saw earlier that this is maximized when: The optimal parameters (0,1), will never be reached by the EM algorithm!

  15. EM for single random variable (dice) Now, the probability of each y(≡(x,y)) is given by a sequence of dice tosses. The dice has m outcomes, with probabilities q1,..,qm. Let Nl(y) = #(outcome l occurs in y). Then Let Nl be the expected value of Nl(y), given x and θ: Nl=E(Nl|x,θ) = ∑y p(y|x,θ) Nl(y),

  16. Q(λ) for one dice

  17. EM algorithm for n independent observations x1,…, xn : Expectation step It can be shown that, if the xjare independent, then:

  18. The ABO locus has six possible genotypes {a/a, a/o, b/o, b/b, a/b, o/o}. The first two genotypes determine blood type A, the next two determine blood type B, then blood type AB, and finally blood type O. We wish to estimate the proportion in a population of the 6 genotypes. Example: The ABO locus A locus is a particular place on the chromosome. Each locus’ state (called genotype) consists of two alleles – one parental and one maternal. Some loci (plural of locus) determine distinguished features. The ABO locus, for example, determines blood type. Suppose we randomly sampled N individuals and found that Na/a have genotype a/a, Na/b have genotype a/b, etc. Then, the MLE is given by:

  19. The ABO locus However, testing individuals for their genotype is a very expensive. Can we estimate the proportions of genotype using the common cheap blood test with outcome being one of the four blood types (A, B, AB, O) ? The problem is that among individuals measured to have blood type A, we don’t know how many have genotype a/a and how many have genotype a/o. So what can we do ?

  20. The ABO locus The Hardy-Weinberg equilibrium rule states that in equilibrium the frequencies of the three alleles qa,qb,qoin the population determine the frequencies of the genotypes as follows: qa/b= 2qa qb, qa/o= 2qa qo, qb/o= 2qb qo, qa/a= [qa]2, qb/b= [qb]2, qo/o= [qo]2. In fact, Hardy-Weinberg equilibrium rule follows from modeling this problem as data x with hidden parameters y.

  21. The ABO locus The dice’ outcome are the three possible alleles a, b and o. The observed data are the blood types A, B, AB or O. Each blood type isdetermined by two successive random sampling of alleles, which is an “ordered genotypes pair” – this is the hidden data. For instance blood type A corresponds to the ordered genotypes pairs (a,a), (a,o) and (o,a). So we have three parameters of one dice – qa,qb,qo - that we need to estimate.

  22. EM setting for the ABO locus problem The observed data x =(x1,..,xn) is a sequence of letters (blood types) from the alphabet {A,B,AB,O}. eg: (B,A,B,B,O,A,B,A,O,B, AB) are observations (x1,…x11). The hidden data (ie the y’s)for each letter xjis the set of ordered pairs of alleles that generates it. For instance, for A it is the set {aa, ao, oa}. The parameters= {qa ,qb, qo} are the probabilities of the alleles. We need is to find the parameters  = {qa ,qb, qo} that maximize the likelihood of the given data. We do this by the EM algorithm:

  23. EM for ABO locus problem • For each observed blood type xj{A,B,AB,O} and for each allele z in{a,b,o} we compute Nz(xj) , the expected number of times that z appear in xj. Where the sum is taken over the ordered “genotype pairs” yj, and Nz(yj) is the number of times allele z occurs in the pair yj. eg, Na(o,b)=0; Nb(o,b) = No(o,b) = 1.

  24. EM for ABO locus problem The computation for blood type B: P(B|) = P((b,b)|) + p((b,o)|) +p((o,b)|)) = qb2 + 2qbqo. Since Nb((b,b))=2, and Nb((b,o))=Nb((o,b)) =No((o,b))=No((b,o))=1, No(B) and Nb(B) , the expected number of occurrences of o and b in B, are given by: Observe that Nb(B)+ No(B)= 2

  25. EM for ABO loci Similarly, P(A|) = qa2 + 2qaqo. P(AB|) = p((b,a)|) + p((a,b)|)) = 2qaqb ; Na(AB) = Nb(AB)= 1 P(O|) = p((o,o)|) = qo2 No(O)= 2 [ Nb(O) = Na(O) = No(AB)= Nb(A)= Na(B)= 0 ]

  26. E step: compute Na, Nband No Let #(A)=3, #(B)=5, #(AB)=1, #(O)=2 be the number of observations of A, B, AB, and O respectively. M step: set λ*=( qa*, qb*, qo*)

  27. Example: the Motif Finding Problem • Given a set of DNA sequences: cctgatagacgctatctggctatccacgtacgtaggtcctctgtgcgaatctatgcgtttccaaccat agtactggtgtacatttgatacgtacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc aaacgtacgtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtacgtataca ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaacgtacgtc • Find the motif in each of the individual sequences

  28. Motif Finding Problem: a reformulation • Collect all substrings with the same length k from the input sequences; • With N sequences with same length L, n=N(L-k+1) substrings can be derived; • Find a significant number of substring that can be described by a profile model.

  29. Fitting a mixture model by EM • A finite mixture model: • data X = (X1,…,Xn) arises from two or more groups with g models = (1, …, g). • Indicator vectors Z = (Z1,…,Zn), where Zi = (Zi1,…,Zig), and Zij = 1 if Xi is from group j, and = 0 otherwise. • P(Zij= 1|) = j . For any given i, all Zij are 0 except one j; • g=2: class 1 (the motif) and class 2 (the background) are given by position specific and a general multinomial distribution

  30. Complete data likelihood • Under the assumption that the pairs (Zi,Xi) are mutually independent, their joint density may be written • P(Z, X| ) = ∏ij [j P(Xi|j) ] Zij • The log likelihood of the model is thus • log L(,  | Z, X) = ∑∑ Zij log [ j P(Xi|j) ]. • The EM algorithm iteratively computes the expectation of the likelihood given the observed data X, and initial estimates ’ and ’ of  and  (the E-step), and then maximizes the result in the free variables  and  leading to new estimates ’’ and ’’ (the M-step).

  31. Mixture models: the E-step • Since the log likelihood is the sum of over i and j of terms multiplying Zij, and these are independent across i, we need only consider the expectation of one such, given Xi. Using initial parameter values ’ and ’, and the fact that the Zij are binary, we get • E(Zij |X,’,’)=’jP(Xi|’j)/ ∑k ’kP(Xi|’k)= Z’ij

  32. Mixture models: the M-step • Now we want to maximize the result of an E-step: • ∑∑ Z’ij j +∑∑ Z’ij log P(Xi | j). • The maximization over  is independent of the rest and is readily achieved with • j’’ = ∑iZ’ij / n.

  33. Mixture models: the M-step Note, P(Xi|1) = ∏j∏k fjkI(k,Xij) , and P(Xi | 2) = ∏j∏k f0kI(k,Xij) where Xij is the letter in the jth position of sample i, and I(k,a) = 1 if a=ak, and =0 otherwise. c0k = ∑∑ Z’i2I(k,Xij), and cjk = ∑∑ Z’i1I(k,Xij). Here c0k is the expected number of times letter ak appears in the background, and cjk the expected number of times ak appears in occurrences of the motif in the data. f’’jk = cjk / ∑k=1L cjk , j = 0,1,…,w; k = 1,…,L. In practice, care must be taken to avoid zero frequencies, so one adds pseudo-counts: small constants j ,∑j = , giving f’’jk = (cjk+ j )/ (∑k=1L cjk + ) , j = 0,1,…,w; k = 1,…,L.

More Related