Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
SOLiD color space PowerPoint Presentation
Download Presentation
SOLiD color space

SOLiD color space

117 Vues Download Presentation
Télécharger la présentation

SOLiD color space

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. SOLiD color space

  2. File management

  3. Szekvenciák, kontiggá valóösszerakása I. Tévedések vígjátéka

  4. A scaffold fogalma Szekvenálási lyukak Nincs kapcsolat Kontig 3 Kontig 1 Kontig 2 Kontig 4 Kontig 5 Scaffold 1 Scaffold 2 összekapcsolás: kozmidkönyvtár (BAC, YAC) klónok végeinek szekvenciái két küldönböző kontigra esnek Scaffold: láncszerűen lineáris sorrendbe elhelyezett nem összeérő kontigok sora.

  5. Kontigokszuperkontigokká való összerakása

  6. KOMBINATORIKUSPCR

  7. cos cos Ampr ori Genomi DNS részleges emésztése MboI (Sau3AI)-gyel (kompatibilis véget ad a BamHI-véggel) A 30 – 45 kb régió méret szerinti elválasztása BamHI- XbaI emésztés ligálás 30 – 45 kb-os fragmentek cos cos in vitro pakolás GigaPack l fehérje extraktummal szelekció ampicillin rezisztens klónokra KOZMID KÖNYVTÁR kozmid könyvtár

  8. Mesterséges kromoszómák: BAC (bacterial artificial chromosome) vektorok

  9. Mesterséges kromoszómák: YAC (yeast artificial chromosome) vektorok

  10. 454 PE library generation

  11. Egy tipikus példa párosított végszekvenálásra, 454, PE

  12. Solexa párosított végszekvenálás I.

  13. Solexa párosított végszekvenálás II.

  14. Solexa párosított végszekvenálás III.

  15. PRIMERSÉTA Kozmid,BAC,YACkönyvtárakban TEMPLÁTGENERÁLÓRENDSZER Azintegrációhelyétellenőriznikell NagykapacitásúautomataSouthernhibiridizáció

  16. Összerakó algoritmusok (Assemblers) Buzgó (greedy) algoritmus Átfedési-szerkezet-konszenzus

  17. De ha sikerül, és van szekvenciánk Mi van rajta,van-egén? Honnan tudjuk, hogy Valamit találtunk, találtunk-e gént? CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGA TCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGG TCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTT CGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAG GGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGC CGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGT CCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCA TTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCG AGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC GGGAATGCTTCGTGTTGAAGTGGCCCTGGCGCGCGCGCAGGCGGCAGAGGGCCTTGTCAGTTCGGAATTGGCCGACGCGATCGAGGTTGTTGGTACTGCCGGGTTGGACCCCGAGGCGAT GGCGGCGACTACTCGCATGACAGGAGTGCCCGCAATATCGTTCGTCCGTGCGGTGCAATCGGCCCTGCCGCCCTCACTGGCGGGTGGATTTCATTTCGGCGCCACCAGTCAAGACATCGT GGATACGGCCCACGCGCTCCAGCTGGCCGAGGCACTCGATATTATAGAAGTCGATTTACACGCCACTGTCAGCGCAATGATGAATCTGGCCGCTGCTCACTGCAATACACCCTGTATCGG GCGCACGGCCTTGCAGCACGCAGCGCCAGTTACGTTCGGCTACAAGGCGTCCGGCTGGTGCGTTGCCCTGGCGGAGCATCTGGTGCAGCTTCCCGCGCTGCGAAAGCGGGTTCTGGTGGC GTCGCTAGGGGGGCCGGTTGGTACCCTTGCCGCGATGGAGGAGCGGGCCGACGCTGTACTGGAGGGTTTCGCTGCGGACCTGGGGTTGGCCATTCCCGCCCTGGCCTGGCACACGCAGCG GGCCCGGATCGTCGAGGTGGCCAGTTGGCTGGCCATATTGCTGGGAATTCTGGCAAAAATGGCCACCGATGTCGTTCACTTGTCCTCCACGGAAGTGCGCGAGCTTTCCGAACCTGTAGC GCCGGGCAGGGGGGGCTCCTCGGCGATGCCTCACAAGCGGAACCCGATTTCCTCGATTACCATCCTGTCCCAGCATGCTGCGGCAGGGGCCCAGCTCTCCATTCTCGTGAACGGCATGGC CAGTCTGCACGAACGTCCGGTGGGGGCGTGGCATTCGGAATGGTTGGCTCTGCCGACGCTGTTCGGCCTTGCCGGCGGTGCCGTGCGCGAGGGCAGGTTTCTGGCCGAGGGGCTGCTGGT CGATGCCGACCAGATGGGTCGCAATCTACAATTGACCAATGGCCTGATTTTCAGCGACGCGGTAGCCGGCCAGTTGGCAAAGCACTTGGGTCGGGCCGAGGCTTATGCCGCTGTCGAGGA TGCCGCCGCCGAGGTGTTGCGTTCAGGCGGCAGCTTTCAGGGTCAGCTGAACCAGCGCCTGCCCGATCACCGCGACGCTATCGCTATTGCTTTTGATACGACGCCGGCGATCCAGGCCGG GGCCGCCCGCTGCCGTAGTGCGCTGGATCATGTGGCTCGTATTCTTGGACCCGCCTCTACCATCGGATTTCAAGGAGGCTAATGACGTGACGACACTGTTTGAGGCGACGACCATCCCGA TTTGCGAGGGCCCGCGCGACCAGACCGCCGAGATCCTTTTCGAGATGCCGCCGGGTGCGTGGGATACCCATTTTCATGTTTTTGGCCCAGTTTCATCGTTTCCATACGCAGAACACAGGC TCTATTCCCCACCGGAGTCGCCACTTGAGGATTATCTGGTGTTGATGGAGGCTTTGGGGATCGAGCGCGGCGTTTGTGTCCATCCGAATGTTCATGGTGCCGACAATTCGGTGACGCTCG ACGCAGTTGCGCGGTCCGATGGTCGTCTGCTGGCGGTGATCAAGCCACATCACGAGATGACTTTTGTTCAGCTGCGGGACATGAAGGCGCAGGGGGTCTGCGGGGTACGTTTTGCCTTCA ATCCGCAGCATGGCTCGGGCGAGTTGGATACTCGTTTGTTCGAGCGTATGTTGGACTGGTGCCGCGACCTAGGCTGGTGCGTAAAATTGCATTTCGCGCCCGCTGCGCTGGACGGTCTGG CTGAACGTTTGGCGCGCGTCGATATTCCGATCATCATCGATCATTTCGGGCGGGTGGACACCGCGCAAGGTGTGGATCAGCCGCACTTCCTGCGTTTGCTCGATCTGGCCAAACTGGACC ATGTCTGGATCAAGCTTACGGGGGCAGATCGTATTAGCGGTTCCGGCGCGCCATATGACGATGTCGTGCCCTTCGCGCACGCTTTGGCAGATGTGGCGCCCGACCGCCTCCTCTGGGGTT CGGATTGGCCGCATTCAGGCTATTTCGATCCGAAGCACATACCCAATGACGGCGACTTGTTGAACCTTTTGGCGCGTTTTGCCCCCGATGCTGAACTGCGTCGTAAGATCCTTGTGGACA ACCCGCAGCGCCTGTTCGGGGCTGCTTGAGGAGCCGAGCCGATGCAACCTTTCGTCTACGAAACAGCCCCAGCGCGCGTCGTTTTCGGGCGCGGCACTTCGCAGAATCTGCGGCGGGAAC TTGAGGCCCTGAATTTTGGCAGGGCGCTGGTTCTTTCCACGCCCGACCAAAAAGAACAATCGCTGCGAATTGCCCAGGGCCTGGGTTCTCAGCTGGCGGGGTCGTTCCACGCCGCTGCCA TGCATACGCCTGTCGAGGTCACCTTGCAGGCGCTTGAGGTGCTGAAGGATGTGCAGGCCGATTGCATCGTGGCGATTGGCGGCGGCTCAACCATTGGGTTGGGCAAGGCACTGGCCCTGC GCACCGATCTGCCGCAGATCGTCGTCCCGACGACTTATGCCGGCTCGGAAATGACGCCGATCCTGGGAGAGACGGAAAACGGGCTGAAGACCACACAGCGTAATCCCAAAGTGCAGCCGA GGGTGGTTCTCTACGATGTGGACCTGACTGTGACGCTTCCGGTGCAGGCCTCGGTTACATCAGGCATGAATGCGATCGCCCATGCGGCCGAGGCATTATATGCGCGGGACGGCAATCCGG TGATCTCGCTGATGGCCGAAGAGGCGATCCGCGCGCTGGCCCATGCCCTGCCGCGTATCGTTGCCACTCCCGACGATATCGAAGCGCGCAGCGATGCCCTCTATGGCGCGTGGCTGTGCG GAACGTGCCTGGGTTCGGCCGGAATGGCGTTGCACCATAAGCTCTGCCACACCCTCGGCGGAAGTTTCGATTTGCCACATGCCCCGACCCACACGGTCATCCTCCCCTATGCGCTCGCCT ATAATAGTGATGCGGCCAGGCCCGCAATGGCAGCCATCGCGCGCGCGCTGGGCATGGCGGATGCAGCGATGGGCATGAGAGCGTTGTCCATGCGGTTGGGCGCCCCGACATCGCTGCGTG AGTTGGGCATGGCAGAAGCCGATCTTGACCGCGCCGCCGACCTGGCCACGCAAAATGCCTATTGGAACCCGCGACCCATCGAGCATGGGCCGATTCGTAACCTTCTGGGACGGGCCTGGG CTGGAACTCCGGTCTGAAGGACCTAGAGGACAGTCAATTCATTGATCTGAAGTCACCAACGAGGAGATATGGGATGAACGAGAACATTGCGATCCGCAAATTGGGCCGCCGACTCCGATT GGGCATTGCCGGTGGCGCGGGTCATTCGCTGATTGGTCCGGTTCACCGGGAGGCGGCTCGGCTTGACGATTTGTTCTCTCTCGATGCTGCGGTGCTGTCCAGTAACGCGGAACGCGGGGA TGCTGAGGCCGCGGCTCTCGGAATTCCGCGCTCCTATTCGTCCACCGCCGAGATGTTCGCAATGGAGAAGGCTAGGCCCGACGGTATTGAGGCCGTTGCCATAGCCACGCCGAATGACAG CCATTACCGGATTCTGTGCGAGGCGCTGGACGCCGGGTTGCATGTAATCTGCGACAAGCCTTTAACCTCCACGAAGGCCGAGGCCGACGACGTGCTGGTGCGGGCGAAGGCCGCGGGCAA GGTTGTGGTCCTGACCCACAATTATTCTGGCTACGCCATGGTACGCCAAGCCCGCGCCATGGTCGCCGCCGGTGAACTTGGGAAAATCCACCAGATTCACGGGGTCTACGCTCTGGGCCA GATGGGCCGTTTGTTCGAGGCCGACGAAGGGGGCGTGCCTCCGGGGATGCGTTGGCGGATTGATCCTGCGCGCGGTGGCGACAGTCACGCCCTGGTGGATATCGGCACCCATGTGCACCA TCTGGCTACCTTCATCACGCAGTTACAGGTCGTTGAGGTAATGGCCGATCTTGGGCCGGCGGTTCAAGGCCGCGCGGCCCATGACAGTGCCAACGTCATGTTCCGTATGGAAAACGGAGC TTTCGGATCGTTCTGGGCCACCAAGGCGGCATCGGGGGCCAGCAAGCTGGCGATCGAAGTCTACGGTGACAAGGGCGGCGTCCTGTGGGAGCAGGCCGACGCCAATAACTTGCTACATAT GCGGCAGGGCCAACCCCCAGCCCTGATTGGTCGACAAGTTGCCGGGCTGCATCCTGCGGCAATCCGCGCGATGCGGGGGCCGGGTTATCATTTCGTGGAAGGCTATCGCGAGGCCTTTGC GAATATGTACGTGGATTTCGCCGAACAGATCTTGGCCATGATGGGCAAGGGGGCCGCAGATCACCTGGCATTGGAAGCGCCGTCGGTCGTGGACGGCCTGCGCTCCATGGCGTTCATCGA AGCCTGTGTGGCGTCGTCGCAGGACCGCCAATGGCGGCAGGTGGAGCAAGTCAGTTGATCTCTCAGCGGCTTCGGCATTTTTCCCGGGCTGGCGGCTCCCCGCAGCTCCCTCCGGTGGAA AGAACGGGTAATCAAAATAATATTCTGATTTTAAAGGATGTTCCAGACAGCTGATTATTCCTGAAATTTAGGGCTCTTTCGGCTGTAGCAATTGACTAAAAGCCGAATTTAAGGGTAATTAAACAAACGCTGTTCGTATTATTTAAACAGGTGAGTGATGGCGATATTCCTGGAAGGCTGGCCGATGGTTTCATCTGAATACCCGGCCAGAAGCGTTGAGGCGCACCCGGCCTATCTGAC GCCAGACTATGTTTTCACGCGAAAGCGTGCGCCGACTCGACCGCTGCGGTTAATTCCTCAGTCTGCGACGGAGCTGTATGGCCCGGTTTATGGACAAGAGAGCGTCCGTCCGGGGGATAA CGACCTGACCCGTCAGCACGAAGCTGAGCCGGTGGGGGAGCGGATTCTGGTGACGGGGCGCGTGACCGACGAAGACGGGCGGGGTGTCCCTAATACGCTGCTAGAGATCTGGCAGGCCAA TGCCGCCGGTCGCTATATCCACAAGCTTGACCAGCATCTTGCCCCGCTTGATCCAAATTTCTCGGGGGCAGGGCGTACGGTTACGGGGGCTGATGGCTCTTATTCCTTCATCACGATCGT GCCGGGCGCCTATCCGGTCGTGGGGCTGCACAATGTCTGGCGCCCGCGCCACATCCATGTGTCGTTGTTCGGTCCGTCCTTCGTGACCCGCTTGGTTACCCAGATATATTTCGAGGGCGA TCCGCTGCTGAAATATGACACGATCTACAACACGGCGCCCGACATCTCGAAGCGCAGCATGGTGGCGCAGTTGGACATGGGCGCCACGCAATCCGAATGGGGCCTGACCTATCGCTTCGA CATCGTTCTGCGTGGGCGCAACGGCAGCTATTTCGAGGAACCCCATGACCACTAAGACCCCACTGACCATCACCCCCTCGCAGACTGTCGGGCCTTTCTATGCCTATTGCCTGACCCCGG AGGACTACGGGACGCTTCCACCGCTGTTCGGCGCGCAGCTTGCGACCGAGGACGCCGAAGGGGAACGGATTACGATCCAGGGAACGATCACGGACGGAGAGGGGGCCATGGTTCCCGATG CCTTGATCGAGATCTGGCAGCCGGACGGGCAGGGGCGTTTTGCTGGAGCCCATCCAGAGCTGCGGAATTCGGCCTTCAAGGGCTTCGGGCGCCGCCACTGTGACAAAAGCGGAAACTTCA GTTTCCAAACCGTGAAGCCTGGCCGGGTGCCCACTGCCGACGGCGTGATGCAGGCACCCCATATCGCTTTGTCGATCTTCGGCAAGGGATTGAACCGCCGGCTCTATACGCGGATCTACT TCGCAGACGAGGCATCGAATGCCGAGGACCCCGTTCTGTCGATGCTGTCCGAGGATGAGCGCGTGACCCTGATCGCCACCTCTGAATCGCCCGCCGCATATCGCCTCGACATCCGCCTGC AAGGCGACGGCGAAACGGTGTTTTTCGAGGCCTGAGTCGGCCGGCAAGTTTGCGGGGATCCGTCCGCCGCAATTGTGTTTCGCTATAGACGCCACGGCTGCCGCATGCCGCCGGGTGGAA GGGCCTTGCAAGGCCTGTCAACGGCGGAGTAAAATCCGGCCAGGCGGCGGAGTAAAACCAGGCCACTTGTGGCCCACGCATGAGACACCCGGGAGGGCGTAGCCCAAGCGGGGGTCTCAT GCGTGTGCGGCGGTTTTCTGGGGGTTCAGCCAGCCTTGCGGGCGCGGCTTTGAGCGAGACGATAGCTGTCGCCGTTCATCTCGAG

  18. Hasonlóság CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGATCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGGTCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTTCGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAGGGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGCCGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGTCCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCATTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCGAGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGATCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGGTCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTTCGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAGGGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGCCGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGTCCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCATTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCGAGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC a két szekvencia teljesen ugyanaz

  19. Hasonlóság Most is - majdnem CTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGATCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGGTCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTTCGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAGGGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGCCGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGTCCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCATTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCGAGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC AAACTCGAGACGCTGTTTCTGGGGTCATTCATTCTTGGCGGGCTGCAACTGCTGGTGTGACCGACGCGACCTGGCAGGCCGCGGTGCGCAACTGGCCGGGCGGACTAATGGTGGAGCAAAAGATCGGCATGTCCAGCGCACCTGAAGCTTGGGTGGTTGCTGCAATAGCAGCCTTCCTTATTGGCATGGCGAAGGGCGGTTTGGCCAATGTGGGGGTTATCGCCGTTCCCTTGATGTCCCTGGTCAAGCCGCCGCTTACCGCTGCCGGATTGCTGCTCCCGATCTATGTCGTTTCTGATGCATTCGGCGTCTGGCTTTATCGGCACCGGTATTCTGCCTCCAATCTGCGCATCCTGATTCCTTCGGGATTTTTTGGGGTCCTGATTGGCTGGTTATTGGCCGGGCAGATCTCCGACGCGATTGCCAGTGTCATTGTTGGTTTCACCGGCTGCGGCTTCGTGGCTGTGCTGCTGGCACGACGAGGGGTGCCATCGGTGCCGCGTCAAGCCAACGTGCCCAAAGGATGGTTTCTGGGGGTGGCCACCGGCTTTACCAGCTTTTTGACTCATTCCGGTGCGGCGACCTTCCAGATGTTCGTGCTGCCGCAACGGCTGGACAAGACCATGTTCGCGGGCACATCAACGCTTACCTTTGCTGCCATAAACCTATTCAAGATTCCGTCCTACTGGGCATTGGGACAGCTTTCGACTTCCTCGGTCATGTCCGCGCTAGTGTTGATTCCGGTGGCCGTGGCCGGGACGTTCGCAGGTGTTTTTGCGACGCGCAGGCTATCGACATCCTGGTTCTTCATTCTGGTCCAGGCGATGTTGCTGGTGGTCTCCATTCAGCTTCTGTGGAGGGGAATGTCGGATATCCTGAACTAGCTGGAGATCGCAATGTCAGAACGCTCAATCAATCAGAATGTAATCTTGACATAGAATACCGTTCCGATTTATTGCTTCGAGTGAAGCTGCCCGTCCGCTGAGATGTCATGACATTTTCCCCGCTTGATTCCGCCCTGCTTGGACCGTTGTTCGCGACCGATGAAATGCGCACGGTCTTCTCCGAACGGCGTTTTTTGGC BLASTN, FASTA GLOBÁLIS, LOKÁLIS

  20. ANALÓGIÁK - ADATBANKOK Összahasonlítás már ismert elemekkel

  21. … és kódol-e fehérjét? Open reading frames: nyitott leolvasási keretek Áltában ATG-vel kezdődik, de opció Hossz: ajánlás 100 aminosav, de opció Az eredmény hipotetikus, össze kell vetni a valósággal Hipotetikus fehérje lista  hasonlóság  BLASTP Információból információ generálása Problémák: frameshift mutáció, a globál hasonlóság csődje Hol kezdődik? Mi a start?

  22. Egy régió nyitott leolvasási keret térképe

  23. Hol kezdődik? Ki tudja? Egyéb elemek azonosítása, genomi elrendeződés Kísérletes ellenőrzés

  24. ...a reálisabb kép, hasonlóság keresés után