kera
Uploaded by
49 SLIDES
688 VUES
490LIKES

Molecular Genetics & Gene Function

DESCRIPTION

Molecular Genetics & Gene Function. NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS. Concepts We Already Know:. Chromosomes Genome Genes Central Dogma of Molecular Biology DNA, RNA, proteins Hershey-Chase experiment Mendel’s laws of heredity Alleles

1 / 49

Télécharger la présentation

Molecular Genetics & Gene Function

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Molecular Genetics & Gene Function • NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS

  2. Concepts We Already Know: • Chromosomes • Genome • Genes • Central Dogma of Molecular Biology • DNA, RNA, proteins • Hershey-Chase experiment • Mendel’s laws of heredity • Alleles • Heterozygous vs. Homozygous

  3. Regulation: DNA switched on Transcription: DNA mRNA Translation: mRNA protein

  4. . . Human Genome 100% transcribed transcribed, both strands Messenger RNAs ~ 2% Mattick, J., Human Molecular Genetics, 2006, Vol. 15, Review Issue 1

  5. Meaning of a genetic code Proteins The structure of DNA: variable sequence (string) built of 20 amino acids (building blocks) strings of amino acids fold up into particular shape Shape governs the Function (Meaning)

  6. The Central Dogma of Molecular Biology: 1) DNA encodes RNA 2) RNA encodes Proteins 3) Proteins encode shape / function DNA  RNA  Protein Genetic information (the MEANING) is encoded in the SEQUENCE of basis along the DNA strand; DNA is not a direct template for protein synthesis;

  7. The Codon Code Triplets of RNA bases translate to particular amino acids. Triples are called Codons.

  8. Codons are three-base strings, so the number of possible codons are theoretically 4·4·4 = 64 There are 20 amino acids This includes the 1 START codon (Methionine)‏ What is the biological significance of the extensive redundancy of the genetic code ??? The 3 STOP codons don't code for amino acids

  9. The Central Dogma of Molecular Biology . . . AAAGCUUUUUAUGCGUUCAAG . . . . . . AAAGCTTTTTATGCGTTCAAG . . .

  10. Lys Lys Ala Phe Tyr Ala Phe

  11. Essential amino acids: • Isoleucine, • Leucine, • Lysine, • Methionine, • Phenylalanine, • Threonine, • Tryptophan • Valine.

  12. Real Genes: Globinfind the start site • atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • atggtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

  13. Real Genes: Globinnow find the stop codon • atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc START of globin

  14. Real Genes: Globin • atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc STOP of globin

  15. atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

  16. Activity: Sickle cell anemia

  17. DNA-based life is Chemical & Meaningful • Chemical: Molecules that encode hereditary information are complex, yet built out of the same atomic set: in particular C, H, O, N, P, and S. • Meaningful: Sequences or strings of bases encode meaningful information (govern structure & function of proteins).

  18. DNA-based life is Improbable & Historical • Improbable: Likelihood of 2 DNA sequences being equal by chance is exceedingly small. • Historical: If you took at two people and compare a small stretch of their DNA, the chance that that small stretch agrees in all but one base pair is extraordinarily tiny if due to pure chance. It is far more likely that the correct explanation should be that all humans are related by some sort of process of inheritance. Inheritance implies ancestry, which in turn implies history. • Humans share ~99.8 % of DNA with one another, • ~98% of DNA with chimpanzees (our closest living relatives), • and some fraction of DNA with all life on Earth.

  19. DNA-based life is Improbable & Historical

  20. Probability: one way of quantifying what outcomes are liable to be observed • Probability P = (number of outcomes of interest) / (number of possible outcomes) • Always a number between zero and one • P(A OR B OR C) = P(A) + P(B) + P(C) • P(A AND B AND C) = P(A) x P(B) x P(C)

  21. What is a virus? DNA or RNA molecule carrying virus’ genetic code Encapsulated into protective protein shell (capsid) Ex: HIV is a strand of RNA capable of transferring its information “backwards” into the cell’s DNA. New Central Dogma of Molecular Biology: Viruses generally cannot self-replicate So they hijack the cell’s machinery DNA  RNA  Protein

  22. Vaccines against Viral Infections Potential Problem: The vaccine version of the virus reverts to a virulent form. QUESTION: Suppose the chance of a base mutating is 20%, and chance to mutate back to original base is 1/3. What is the chance that base in a modified virus will revert back to what it was originally? QUESTION: Some poliovirus vaccines involves 5 effective mutations that weaken the virus. Imagine that the vaccine is administered to 5,000,000 people. How many people are liable to be infected by harmful polio that originates from a reversion of the vaccine?

  23. Activity: Bioinformatics Group Activity Blasting DNA http://serc.carleton.edu/microbelife/k12/bioinformatics/index.html

  24. Mammals that have been sequenced (cont) Source: wikipedia.org

  25. Mammals that have been sequenced (cont) Source: wikipedia.org

  26. Mammals that have been sequenced (cont) Source: wikipedia.org

  27. Other Vertebrates That have been Sequenced Source: wikipedia.org

  28. Other Vertebrates That have been Sequenced Source: wikipedia.org

  29. Insects that have been sequenced Source: wikipedia.org

  30. Insects that have been sequenced (cont) Source: wikipedia.org

  31. Announcement: Your presentations are due by email Monday night. If they aren’t in by then you will not be permitted to present and your group will get a ZERO.

  32. Using DNA to our Advantage • Genetic Modification • Introduction of new DNA sequences into an organism to alter the genetic makeup • Introduces very specific characteristics • Use enzymes to manipulate DNA • Recombinant DNA - new form of DNA that is introduced • Gene cloning – splicing genes from a variety of species into a host cell • Gene therapy – inserting, deleting or manipulating genes in order to cure or lessen the effects of genetic diseases

  33. Using DNA to our Advantage • Sequencing • Compare nucleotide sequences from different cells • Analyze for similarities and differences • PCR (polymerase chain reaction)  copying selected segments of DNA • Genetic fingerprinting • Cloning

  34. Discussion Activity: GATTACA…our future?

  35. It’s not so far off • The case of 23andme.com

  36. What do you think? If you had the choice would you choose to know your ‘genetic future’?

  37. What do you think? Molecular biology scientists have developed a technique, which enables parents to select the sex of their future child. This technique simply separates the X carrying sperms from the Y carrying sperms, and then inseminating females with the preferred sex chromosomes. This procedure is currently banned in Canada except for medical reasons. Potential parents with sex-linked diseases may choose to have a girl, avoiding the possibility of having a boy with hemophilia, for example. Should sex selection for medical and non-medical reasons be available for parents in Canada or the rest of the world?

  38. What do you think? In the movie clip, the genetic counselor tells the perspective parents: “This child is still you, it is simply the best of you”. How do we understand that statement?

  39. What do you think? • How would we as humans decide what are the best genes to pass on?

  40. What do you think? • How does nature select the best choice of genes to pass on?

  41. What do you think? • What are some of the implications of humans deciding which genes should be selected for? Does such a selection put the entire human population at a greater risk?

  42. What do you think? • In the short clip, the counselor is suggesting that one can screen for alcoholism, baldness, etc., via genetics. How far are we from this level of technology today? Is it even plausible?

  43. What do you think? • In the movie they state that Vincent will have a 60% chance of developing a neurological condition, 42% of being manic depressive, 89% of having ADD, 99% of having heart disease. How accurate are these predictions for the various disorders?

  44. What do you think? Why won’t Insurance cover the medical bills for Vincent? Does that bring the ethical dilemma of DNA testing?

  45. What do you think? Sperm and egg donation service agencies offer hope to infertile parents who hope to conceive their own children in the future. Sperm donation is a relatively easy process, requiring no more than an hour’s time. However, donating eggs is a rather complicated task, requiring months of hormone therapy and minor surgical procedures to retrieve the harvested eggs. In addition, drugs injected into women cause their ovaries to ovulate several eggs at once, greatly increasing the odds of developing cancer. To compensate for the ‘inconvenience’, women are given a large sum of money. Often, young, female college students are targeted for egg donations since they are considered more educated and healthier that their older female counterparts. Do you think females should be compensated for donating their eggs? Why or why not? Is it appropriate for egg donation agencies to advertise for potential egg donors on college campuses?

More Related