1 / 26

Nucleic Acids and Protein Synthesis

Nucleic Acids and Protein Synthesis. DNA Structure. Chromosomes. Chromosomes are thread-like structures found in the nucleus of the cell. They contain DNA (deoxyribonucleic acid). A molecule of DNA consists of two strands made up of repeating units called NUCLEOTIDES. A DNA Nucleotide. base.

kiora
Télécharger la présentation

Nucleic Acids and Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Nucleic Acids and Protein Synthesis DNA Structure

  2. Chromosomes • Chromosomes are thread-like structures found in the nucleus of the cell. • They contain DNA (deoxyribonucleic acid). • A molecule of DNA consists of two strands made up of repeating units called NUCLEOTIDES.

  3. A DNA Nucleotide base phosphate deoxyribose sugar

  4. Bases • There are 4 different bases therefore 4 different nucleotides • ADENINE (A) • GUANINE (G) • THYMINE (T) • CYTOSINE (C)

  5. Base Pairs • To form a double strand the bases pair up. • Adenine always pairs with Thymine • Cytosine always pairs with Guanine

  6. Fill in the complementary base partner to each nucleotide

  7. Were you correct?

  8. Bonds • Hydrogen bonds form between bases. • Strong chemical bonds form between the phosphate group of one molecule and the deoxyribose sugar of another.

  9. Strong chemical bonds

  10. Double Helix

  11. Replication Requirements • DNA TEMPLATE • 4 TYPES OF NUCLEOTIDES • ENZYMES (DNA polymerase) • ATP for energy

  12. DNA Replication DNA unwinds DNA unzips and H bonds break Free nucleotides find complementary partner, H bonds form Strong chemical bonds form and DNA winds back up

  13. Semi-Conservative Replication Original strand New strand

  14. Coding • Bases code for amino acids. • Amino acids code for proteins • The sequence of bases that are unique to the organism.

  15. An RNA Nucleotide base phosphate ribose sugar

  16. DNA Double Strand Thymine base pairs with adenine Deoxyribose Sugar RNA Single Strand Uracil base pairs with adenine Ribose Sugar DNA and RNA Differences

  17. Types of RNA • Messenger RNA (mRNA) – carries the genetic information from the nucleus to the cytoplasm for protein synthesis. (codon) • Transfer RNA (tRNA) – Carries amino acids on the anti-codon to the appropriate codon to form a polypeptide.

  18. DNA to Protein

  19. DNA – mRNA – tRNA - Protein Complete the sequences of mRNA and tRNA then using Torrance pg 344 find out the names of the amino acids. DNA - TTACGGCAATGCGGTACCGTTGGGGGCAG mRNA - Codons (set of 3 bases) tRNA - Anti-codons (set of 3 matching bases) Protein -

  20. DNA – mRNA – tRNA - Protein DNA - TTACGGCAATGCGGTACCGTTGGGGGCAG mRNA - AAUGCCGUUACGCCAUGGCAACCCCCGUC Codons (set of 3 bases) tRNA - UUACGGCAAUGCGGUACCGUUGGGGGCAG Anti-codons (set of 3 matching bases) Protein - aspn– ala – val – thr – pro – try – glu – pro - pro

  21. Overview

  22. Transcription

  23. Stages in Transcriptionsheets pg 20 • DNA helix unwinds • DNA molecule unzips – weak H bonds break • mRNA nucleotides pair up with complementary base on DNA molecule • mRNA nucleotides loosely held in place by H bonds to DNA molecule • Enzyme forms bond between sugar and phosphate on mRNA nucleotides • mRNA bases become detached from DNA molecule • mRNA molecule leaves nucleus through pore in nuclear membrane • H bonds between DNA bases reform. DNA coils back up into double helix

  24. Translation

  25. Fate of Protein • The protein is carried in a vesicle from the RER to the Golgi where it is processed and packaged into a vesicle which fuses with the cell membrane.

More Related