koto
Uploaded by
36 SLIDES
528 VUES
360LIKES

Genetic Technology

DESCRIPTION

Genetic Technology. DNA Fingerprinting. We can compare DNA from two people by running each person’s DNA on a gel. (GEL ELECTROPHORESIS ) It is not an actual fingerprint, but unique in that every person has different DNA sequences (except for identical twins ).

1 / 36

Télécharger la présentation

Genetic Technology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Genetic Technology

  2. DNA Fingerprinting • We can compare DNA from two people by running each person’s DNA on a gel. (GEL ELECTROPHORESIS) • It is not an actual fingerprint, but unique in that every person has different DNA sequences (except for identical twins). • Therefore, they will have different band patterns in a gel.

  3. Applications of DNA Fingerprinting • Determine paternity • The bands from a gel electrophoresis of a child’s DNA will match with the mother’s or father’s • Crime Scene applications • It is hard to find an intact fingerprint at a crime scene; it is easier to find bodily fluids, hair and skin cells left behind • Personal Identification, for example: US Military

  4. GENETIC ENGINEERING

  5. Tobacco Plant Firefly

  6. How are restriction enzymes useful? • We can cut whole genes from an organism (ex: protein that produces light from firefly). • We can insert that gene into a plasmid (bacterial DNA). • We can then put that whole bacterium into a tobacco plant. • The bacteria replicates and produces the protein inside the plant. The plant expresses the protein. Plant glows like a firefly.

  7. Spider Silk—is the strongest material known to man! Goat—Produces milk

  8. The female genetically modified goats can act like silk protein factories when they give birth and start producing milk.

  9. How in the world did that happen?! First you find the gene that you want to transfer over Then you must cut that gene out of the parent DNA The area where you want to put the DNA in the other organism has to be found Cut the new DNA so you can insert into vector Gene put into new organism

  10. GGAATTCCTTAAGTCAACCGCTTAAGG 1. Gene you want. Makes Human insulin GGAATTCCTTAAGTCAACCGCTTAAGG 2. Cut out by restriction enzymes GTACTGACCCTTGGTA AGAGTACGTTTGT 3. DNA inside vector cut with restriction enzymes BACTERIA VECTOR 4. Insert Insulin Gene here! 5. Bacteria produces insulin !!!

  11. What is a vector? A vector is a virus that has been re-engineered OR a plasmid, which is a ring of DNA found in bacteria Transgene Plasmid Transgene Virus

  12. Bacteria act as vectors Plasmid (reproduces independently of chromosome) Bacterial chromosome

  13. So why don’t we make all kinds of new animals and plants? We don’t know how it will affect our environment What other effects will it have besides the one intended They can mutate Examples of genetically modified organisms that we have now……… Sterile male crop pests Plants that have an insecticide in them

  14. What are Restriction Enzymes? Remember DNA structure?? Base Pair Nitrogenous Bases

  15. Restriction enzymes are proteins that cleave (cut) DNA molecules at specific nucleotide sequences (A,T,C, and G). Example: HobI cleaves at the sequence CAATTG

  16. Each restriction enzyme cleaves DNA at a different sequence. • Enzyme recognition sites are usually 4 to 6 base pairs in length. • The fragments created can be separated by gel electrophoresis. • Restriction enzymes are taken from a wide variety of bacteria and are thought to be part of the cell's defenses. • The shorter the recognition sequence, the greater the number of fragments generated.

  17. (Restriction Enzyme) (Restriction Enzyme) Recognition Site: G A T A T C G A A T T C Blunt or sticky ends? Blunt Sticky

  18. TRANSGENIC ORGANISMS----

  19. Transgenic Organisms What are they? Organisms that carry genes from another species The first transgenic organisms were bacteria First transgenic animal happened in 1975 A mouse carried an ape gene +

  20. Transgenicorganisms • piggyBac gene from coral inserted into mice. Mice express the red fluorescent protein coded for by this gene. • Also: medicine and spider silk is produced in goat milk. Spider silk could be used to make bulletproof vests and sutures. Jellyfish gene makes pigs look yellow.

  21. Gene Therapy The treatment of certain disorders, especially genetic disorders, by introducing specific engineered genes into a patient's cells Several methods can be used when treating a genetic disorder: A normal gene may be inserted into a nonspecific location within the genome to replace a nonfunctional gene. This approach is most common.An abnormal gene could be swapped for a normal gene.The abnormal gene could be repaired, which returns the gene to its normal function.The regulation (the degree to which a gene is turned on or off) of a particular gene could be altered

  22. So how do we do this? A vector is used to deliver the DNA needed to fix the problem into the target cells……the ones that need to be fixed. Just like in transgenic organisms the vector infects the cells and delivers the DNA into the cell to be put into the target cell’s DNA This new DNA changes the target cells so that they are now normal. What kind of disorders are we talking about here? Hemophilia Sickle Cell Anemia Cystic Fibrosis Huntington’s Disease

  23. Hemophilia is a perfect candidate for gene therapy—it is caused by mutations to a single gene. This could replace the bad gene with a normal gene. A vector is a method of transportation for the gene. Most vectors are harmless viruses. Lab animals have been used to test this method and they have been cured of hemophilia!!!! GENE THERAPY NOT APPROVED BY THE FDA YET !!!!!!

  24. GENE THERAPY IN CYSTIC FIBROSIS These lung cells from a cystic fibrosis patient have been infected with the evolved virus carrying a correct copy of the CFTR gene. The cells with a green interior are expressing high levels of normal CFTR protein, which is a chloride ion transporter that is defective in CF patients because of a mutation in the CFTR gene. The chloride ion transport of these cells was completely repaired with the virus. (Schaffer lab/UC Berkeley

  25. Mark Origer described last night how he was made well enough to attend his daughter's wedding after doctors carried out pioneering gene therapy in which genetically altered versions of his blood cells cleared his body of tumours. Mr Origer, 53, the head of the US post office in Lake Mills, Wisconsin, was diagnosed with melanoma, the most aggressive form of skin cancer, in 1999. His wife, a nurse, had noticed that a mole on his back looked similar to a melanoma shown on a television program. "I was unaware of it," he said. A dermatologist removed the mole. When it tested positive for melanoma, he also removed more surrounding tissue. A cyst subsequently developed at the same site in 2002 and it was found to contain malignant melanoma cells. Despite many treatments being tried, the cancer spread relentlessly. First it reached the lymph nodes under his left arm and, then in June 2004, his liver. Among the treatments he tried were interferon, interleukin 2, a melanoma vaccine and surgery. "There were emotional highs and lows, as we tried something new and then there was a recurrence," he said. In December 2004, he received the new gene therapy from Dr Steven Rosenberg's team at the National Cancer Institute in Bethesda, part of the US government's powerhouse of medical research, the National Institutes of Health.

  26. In earlier work by Dr Rosenberg's team, white blood cells were removed from patients with advanced melanoma, tumour-killing cells isolated, multiplied in the lab and then reintroduced after other white blood cells were removed by chemotherapy. This showed some success, getting tumour regression in half of the patients. This time, the team also genetically altered Mr Origer's white blood cells to recognise and attack cancer cells, making them more effective cancer-fighting cells. To do this, they drew a small sample of his blood that contained normal white blood cells — lymphocytes — and infected the white cells with a retrovirus designed to deliver genes. The virus inserted DNA that enabled the white blood cells to make proteins, called T cell receptors, which recognise and bind to certain molecules found on tumour cells, so they were better able to destroy the cancer cells. Mr Origer – who lives on a farm in Watertown and has two daughters, aged 25 and 16, and a son, aged 23 – was discharged at the end of that December and hoped, most of all, to survive long enough for his eldest daughter's wedding. Although the chemotherapy used to clear the way for billions of his genetically altered white cells had made him feel fatigued, he soon bounced back. In January, a scan showed that his tumours had shrunk by about half. His doctors broke into wide grins as they reported the effects.

  27. In September of last year, his daughter Katie was married and Mr Origer was able to give the bride away. "She wanted me to be there for her, and she wanted me to be there for me. There was a lot of concern from all my children." By the time he walked his daughter down the aisle, only a small spot remained visible in his liver, one that surgeons at the NCI removed in October as part of the protocol of the trial. Study of the "very small" spot revealed that a few cancerous cells remained. On Monday and Tuesday of this week he was given his three-monthly assessment by Dr Rosenberg, which involved a scan. "I'm clean," said Mr Origer. "Perfectly clean. There is nothing showing up on the CT scans. I'm thrilled." Mr Origer, who has had no contact with any other participants in the trial, will continue to go back to Bethesda for follow-up scans. "Naturally, I feel a tremendous indebtedness to Dr Rosenberg," he said. "I know how fortunate I am to have gone through this and responded to this. Not everybody's that lucky." He said that, despite his extraordinary experience, "we try to continue to lead our lives as normally as possible". His married daughter lives only a few miles away, his son remains at home, though works full time, and his younger daughter has just returned to school. "Each day is a celebration, in a sense, because they are days that I would not have had."

  28. GENE THERAPY FOR CANCER TREATMENT

  29. So, Why don’t we cure everybody? FDA has not approved gene therapy because it has provendangerous. Not a permanent cure Our bodies can have an immune response to the vector and DNA. Many diseases are caused by multi-gene problems

  30. Jesse Gelsinger • Jesse suffered from a rare genetic defect in which his liver could not clear his body of ammonia • In 1999 underwent gene therapy; was inserted with a adenovirus carrying a repair gene • The virus attacked his organs • 4 days later, he died at the age of 18 • 1st casualty of gene therapy

  31. Human Genome Project

  32. What is the Human Genome Project? Begun formally in 1990, the U.S. Human Genome Project was a 13-year effort coordinated by the U.S. Department of Energy and the National Institutes of Health. The project originally was planned to last 15 years, but rapid technological advances accelerated the completion date to 2003. Project goals were to: • identify all the approx 20,000-25,000 genes in human DNA, • determine the sequences of the 3 billion chemical base pairs, • store this information in databases, • improve tools for data analysis, • transfer related technologies to the private sector, and • address the ethical, legal, and social issues from HG Project

  33. What's a genome? And why is it important? A genome is all the DNA in an organism, including its genes. Genes carry information for making all the proteins required by all organisms. These proteins determine, among other things, how the organism looks, how well its body metabolizes food or fights infection, and sometimes even how it behaves. The particular order of As, Ts, Cs, and Gs is extremely important. The order underlies all of life's diversity, even dictating whether an organism is human or another species such as yeast, rice, or fruit fly, all of which have their own genomes and are themselves the focus of genome projects. Because all organisms are related through similarities in DNA sequences, insights gained from nonhuman genomes often lead to new knowledge about human biology

  34. http://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/chooser.shtmlhttp://www.ornl.gov/sci/techresources/Human_Genome/posters/chromosome/chooser.shtml

More Related