Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
31 87 pSAT4.hspP. EGFP PowerPoint Presentation
Download Presentation
31 87 pSAT4.hspP. EGFP

31 87 pSAT4.hspP. EGFP

146 Vues Download Presentation
Télécharger la présentation

31 87 pSAT4.hspP. EGFP

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Clone number in the collection Clone number in the collection Vector name Insert template 2298 pSAT6.35SP.MCS.35ST 3187 pSAT4.hspP.EGFP BamHI-EGFP-F SpeI-EGFP-R CGATGAGGATCCGTGAGCAAGGGCGAGGAGC GATACAACTAGTCTTGTACAGCTCGTCCATG Restriction enzymes PCR primers BamHI SpeI BamHI SpeI pSAT6.35SP.EGFP.35ST Resulting clone