lars-sharp
Uploaded by
33 SLIDES
706 VUES
350LIKES

Forensic DNA Analysis (Part II)

DESCRIPTION

Forensic DNA Analysis (Part II). Summary. What is DNA?. Where is DNA found in the body?. How does DNA differ among individuals?. Forensic DNA Analysis. DNA and Statistics. Forensic DNA Analysis. Forensic DNA Analysis. Collection of Evidence. Types of Unknown Samples:

1 / 33

Télécharger la présentation

Forensic DNA Analysis (Part II)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Forensic DNA Analysis (Part II)

  2. Summary • What is DNA? • Where is DNA found in the body? • How does DNA differ among individuals? • Forensic DNA Analysis • DNA and Statistics

  3. Forensic DNA Analysis

  4. Forensic DNA Analysis Collection of Evidence Types of Unknown Samples: • Blood, Semen, Stains, Saliva • Hair, Tissue, Bones, Teeth Types of Known Samples: • Blood or buccal swabs from suspect or victim or other known person

  5. Forensic DNA Analysis Beware of Contamination Contamination occurs when DNA from another source gets mixed in with the sample being collected. • An investigator touches, sneezes, bleeds on a sample. • Wear gloves and use disposable instruments • Package items separately. • Especially, do not mix known samples (from victim or suspect) with unknown samples.

  6. Forensic DNA Analysis Packaging Evidence • Package each item individually. • Put evidence into paper bags, not plastic. • Moisture degrades DNA; air dry samples. • Keep samples at room temperature and out of sun.

  7. Forensic DNA Analysis > History Two main types (90s - Present): Short Tandem Repeats (STRs) • Individual identification possible • Samples: Blood stains, semen Mitochondrial DNA • Used in cases of severely degraded DNA • Individual identification not possible • Samples: Bones, hair shafts

  8. Forensic DNA Analysis > STR • Currently the most used of all forensic markers • Individual identification possible • Type of data used in the FBI CODIS database • People differ in length at these loci • Are located in the nuclear DNA (chromosomes) Short Tandem Repeats (STRs)

  9. Forensic DNA Analysis > STR Short Tandem Repeats (STRs) Person 1..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 6 Person 2..GCCAGCTAGCTAGCTAGCTAGCTTTCAT.. 1 2 3 4 5 Person 3..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT.. 1 2 3 4 5 6 7

  10. Forensic DNA Analysis > STR Locus or Loci: Refers to the location on the chromosome. Allele: Refers to the type of DNA. For STRs, the allele will be the number of repeats. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

  11. Forensic DNA Analysis > STR Example: Locus: D5S818 Alleles: 7,9 Paternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATCC Maternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

  12. Forensic DNA Analysis > STR 13 loci used in CODIS

  13. Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

  14. Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

  15. Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

  16. PCR Hood

  17. The Thermal Cycler Amplifies DNA

  18. Forensic DNA Analysis > STR Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Separation: Separates amplified fragments according to size.

  19. FMBIO Separates and Measures Amplified DNA

  20. Forensic DNA Analysis > STR Color image of gel

  21. Forensic DNA Analysis > STR Gel Electrophoresis Black and white image of STR gel. Samples will have one or two bands at each loci.

  22. Forensic DNA Analysis > STR DNA Profiles are compared TPOX CSF1PO D5S818 D8S1179 Blood stain 7,9 10,13 7,15 8,8 Suspect 1 8,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 3 7,9 10,13 7,15 8,8

  23. Forensic DNA Analysis > STR DNA Profiles are compared TPOX CSF1PO D5S818 D8S1179 Blood stain 7,9 10,13 7,15 8,8 Suspect 1 8,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 3 7,9 10,13 7,15 8,8

  24. Forensic DNA (mitochondria) Mitochondria - The powerhouse of the cell. Mitochondria have their own DNA Mitochondria

  25. Forensic DNA Analysis > Mitochondrial Mitochondrial DNA Ring of DNA YES Double Helix YES Chromosomes NO

  26. Forensic DNA Analysis > Mitochondrial Mitochondrial DNA is only 16,569 letters long [compared to 3 billion in nuclear DNA] There is a 900 base pair region with a 1.7% difference [D loop]

  27. Forensic DNA Analysis > Mitochondrial Nuclear DNA vs. Mitochondrial DNA Double Helix Double Helix 46 Chromosomes One Ring Multiple copies in each mitochondria One copy per cell Multiple mitochondria in each cell MtDNA used for old or degraded samples

  28. Forensic DNA Analysis > Mitochondrial Nuclear DNA: Length is measured mtDNA: Sequence is examined Different colored peaks correspond to a different base

  29. Forensic DNA Analysis > Mitochondrial Basic Steps in Analysis Extraction: Separates DNA from sample Amplification or PCR: Amplifies small portions of DNA (STR regions) Sequencing: Sequence of letters for amplified fragments

  30. Forensic DNA Analysis > Mitochondrial DNA Sequences are compared AGCTAGATCGTTATTCCGAG Hair Sample AGCTAGATCGTTATTCCGAG Victim Conclusion: Hair may have come from the victim.

  31. Forensic DNA Analysis > Mitochondrial DNA Sequences are compared AGCTAGATTGTTATTCCGAG Hair Sample AGCTAGATCGTTATTCCGAG Victim Conclusion: Hair did not come from the victim.

  32. Forensic DNA Analysis > Mitochondrial DNA Sequences are compared AGCTAGATTGTTATTCCGAG Cigarette AGCTAGATCGTTATTCCGAG Suspect #1 AGCTAGATTGTTATTCCGAG Suspect #2 AGCTTGATTGTTATTCCGAG Suspect #3 AGCTAGATTGTTATTCCGAG Suspect #4 Conclusion: Cigarette could be from Suspect #2, Suspect #4 or other person with the same sequence.

  33. DNA and Statistics The final result is presented as a statistic. Do not say: “The DNA in the bloodstain is John Doe’s DNA.” Do say: “The chance that another person has this DNA in the bloodstain is 1 in 300 billion.”

More Related