200 likes | 285 Vues
This thesis outlines the 3D DNA BER pathways in mammals, focusing on nucleotide excision repair and the sequences and organization of the rat PCNA promoter. It examines regulatory elements like AP-1 and ATF/CRE and explores the activation of p53-mediated gene expression in response to DNA damage. Additionally, it delves into the metabolic pathways of reactive oxygen radicals and DNA-PK chapter. The use of EMSA and HPVE6 in chapter 4 shed light on this complex topic.
E N D
Rat PCNA Promoters -693 -240 -70 +125 CAT d693 d240 d70 -70 +125 AP-1 ATF/CRE TGGGTCAGCGCTGTGACGCCA (-64/-58) (-51/-44) UV Serum
UV PCNA
Activation of p53-mediated gene expression in response to DNA damage
Outline of the thesis UV other DNA-PK chapter 2 ATF-1 chapter 2 ? EMSA HPVE6 chapter 4 chapter 3 ? PCNA promoter mRNA protrein chapter 2