lysandra-dodson
Uploaded by
21 SLIDES
418 VUES
210LIKES

Course Sequence Analysis for Bioinformatics Master’s

DESCRIPTION

Course Sequence Analysis for Bioinformatics Master’s. Bart van Houte, Radek Szklarczyk, Victor Simossis, Jens Kleinjung, Jaap Heringa heringa@cs.vu.nl, http://ibivu.cs.vu.nl, Tel. 47649, Rm R4.41. Sequence Analysis course schedule Lectures.

1 / 21

Télécharger la présentation

Course Sequence Analysis for Bioinformatics Master’s

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Course Sequence Analysisfor Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Victor Simossis, Jens Kleinjung, Jaap Heringa heringa@cs.vu.nl, http://ibivu.cs.vu.nl, Tel. 47649, Rm R4.41

  2. Sequence Analysis course scheduleLectures [wk 45] 01/11/04 Introduction Lecture 1[wk 45] 04/11/04 Sequence Alignment 1 Lecture 2[wk 46] 08/11/04 Sequence Alignment 2 Lecture 3[wk 46] 11/11/04 Sequence Alignment 3 Lecture 4[wk 47] 15/11/04 Multiple Sequence Alignment 1 Lecture 5[wk 47] 18/11/04 Multiple Sequence Alignment 2 Lecture 6[wk 48] 22/11/04 Multiple Sequence Alignment 3 Lecture 7[wk 48] 25/11/04 Sequence Databank Searching 1 Lecture 8[wk 49] 29/11/04 Sequence Databank Searching 2 Lecture 9[wk 49] 02/12/04 Pattern Matching 1 Lecture 10[wk 50] 06/12/04 Pattern Matching 2 Lecture 11[wk 50] 09/12/04 Genome Analysis Lecture 12[wk 51] 13/12/04 (lecture rm TBA) Phylogenetics/Overview Lecture 13

  3. Sequence Analysis course schedulePractical assignments • There will be four practical assignments you will have to carry out. Each assignment will be introduced and placed on the IBIVU website: • Pairwise alignment (DNA and protein) (Victor/Radek) • Multiple sequence alignment (insulin family) (Victor) • Pattern recognition (Jens) • Database searching (Jens) • Optionally, you can further do an assignment on programming your own sequence analysis method (assignment ‘Dynamic programming’ supervised by Bart). This assignment will give you bonus points for your final mark but is not required.

  4. Sequence Analysis course final mark Task Fraction • Oral exam 1/2 • Assignment Pairwise alignment 1/8 • Assignment Multiple sequence alignment 1/8 • Assignment Pattern recognition 1/8 • Assignment Database searching 1/8 • Optional assignment 1/8 (bonus) Dynamic programming

  5. Bioinformatics staff for this course • Jens Kleinjung – UD (1/11/02) • Victor Simossis – PhD (1/12/02) • Radek Szklarczyk - PhD (1/03/03) • Bart van Houte – PhD (1/09/04) • Jaap Heringa – Grpldr (1/10/02)

  6. Gathering knowledge Rembrandt, 1632 • Anatomy, architecture • Dynamics, mechanics • Informatics (Cybernetics – Wiener, 1948) (Cybernetics has been defined as the science of control in machines and animals, and hence it applies to technological, animal and environmental systems) • Genomics, bioinformatics Newton, 1726

  7. Bioinformatics Chemistry Biology Molecular biology Mathematics Statistics Bioinformatics Computer Science Informatics Medicine Physics

  8. Bioinformatics “Studying informational processes in biological systems” (Hogeweg, early 1970s) • No computers necessary • Back of envelope OK “Information technology applied to the management and analysis of biological data” (Attwood and Parry-Smith) Applying algorithms with mathematical formalisms in biology (genomics) -- USA

  9. Bioinformatics in the olden days • Close to Molecular Biology: • (Statistical) analysis of protein and nucleotide structure • Protein folding problem • Protein-protein and protein-nucleotide interaction • Many essential methods were created early on (BG era) • Protein sequence analysis (pairwise and multiple alignment) • Protein structure prediction (secondary, tertiary structure)

  10. Bioinformatics in the olden days (Cont.) • Evolution was studied and methods created • Phylogenetic reconstruction (clustering – NJ method

  11. But then the big bang….

  12. The Human Genome -- 26 June 2000 Dr. Craig Venter Celera Genomics -- Shotgun method Sir John Sulston Human Genome Project

  13. Human DNA • There are about 3bn (3  109) nucleotides in the nucleus of almost all of the trillions (3.5  1012 ) of cells of a human body (an exception is, for example, red blood cells which have no nucleus and therefore no DNA) – a total of ~1022 nucleotides! • Many DNA regions code for proteins, and are called genes (1 gene codes for 1 protein in principle) • Human DNA contains ~30,000 expressed genes • Deoxyribonucleic acid (DNA) comprises 4 different types of nucleotides: adenine (A), thiamine (T), cytosine (C) and guanine (G). These nucleotides are sometimes also called bases

  14. Human DNA (Cont.) • All people are different, but the DNA of different people only varies for 0.2% or less. So, only 2 letters in 1000 are expected to be different. Over the whole genome, this means that about 3 million letters would differ between individuals. • The structure of DNA is the so-called double helix, discovered by Watson and Crick in 1953, where the two helices are cross-linked by A-T and C-G base-pairs (nucleotide pairs – so-called Watson-Crick base pairing). • The Human Genome has recently been announced as complete (in 2004).

  15. Genome size Organism Number of base pairs X-174 virus 5,386 Epstein Bar Virus 172,282 Mycoplasma genitalium 580,000 Hemophilus Influenza 1.8  106 Yeast (S. Cerevisiae) 12.1  106 Human 3.2  109 Wheat 16  109 Lilium longiflorum 90  109 Salamander 100  109 Amoeba dubia 670  109

  16. Humans have spliced genes…

  17. CCTGAGCCAACTATTGATGAA DNA transcription CCUGAGCCAACUAUUGAUGAA mRNA translation PEPTIDE Protein A gene codes for a protein

  18. Genome information has changed bioinformatics • More high-throughput (HTP) applications (cluster computing, GRID, etc.) • More automatic pipeline applications • More user-friendly interfaces • Greater emphasis on biostatistics • Greater influence of computer science (machine learning, software engineering, etc.) • More integration of disciplines, databases and techniques

  19. Protein Sequence-Structure-Function Ab initio prediction and folding Sequence Structure Function Threading Function prediction from structure Homology searching (BLAST)

  20. Luckily for bioinformatics… • There are many annotated databases (i.e. DBs with experimentally verified information) • We can relate biological macromolecules using evolution and then “steal” annotation of “neighbouring” proteins or DNA in the DB • This works for sequence as well as structural information • Problem we discuss in this course: how do we score the evolutionary relationships; i.e. we need to develop a measure to decide which molecules are (probably) neighbours and which are not

  21. Modern bioinformatics is closely associated with genomics • The aim is to solve the genomics information problem • Ultimately, this should lead to biological understanding how all the parts fit (DNA, RNA, proteins, metabolites) and how they interact (gene regulation, gene expression, protein interaction, metabolic pathways, protein signalling, etc.)

More Related