Friday March 1, 2013
Friday March 1, 2013. Warm Up: If there are 14 chromosomes in pea plant cells, how many chromosomes are present in a sex cell of a pea plant? AS: Brain Pop DNA. Unit III Genetics MYP Unit Question: How do you get the traits that you have? Area of Interaction: Human Ingenuity.
Friday March 1, 2013
E N D
Presentation Transcript
Friday March 1, 2013 Warm Up: If there are 14 chromosomes in pea plant cells, how many chromosomes are present in a sex cell of a pea plant? AS: Brain Pop DNA
Unit IIIGeneticsMYP Unit Question: How do you get the traits that you have?Area of Interaction:Human Ingenuity
Learning Target:Today we are learning the structure of DNA and how DNA molecules can be copied because DNA makes you who you are!
DNA Structure What do deoxyribonucleic acids look like?
DNA Structure DNA consists of 4 chemicals: Adenine = A Thiamine = T Guanine = G Cytosine = C
These chemicals always pair together Adenine = A Thiamine = T Guanine = G Cytosine = C
Double Helix DNA is in the form of a spiral staircase. This is called a Double Helix
DNA Replication DNA replication occurs when the two sides of the DNA separate and unzip like a zipper.
Two strands from one New DNA bases attach to the unzipped halves, to form new strands of DNA.
DNA Replication This process must happen in cell division.
DNA Mutations The DNA can be thought of as a recipe for proteins. The recipe can be long and looks like this: GTAAGGCGCATTCGTGATCGATCGGTA The recipe can be read like words: GTA AGGC GCA TTC GTGA TGCA The words can be read in sentences: GTA AGGC GCA TTC GTGA TGCA These sentences are called genes. A recipe for cookies would include: Flour, eggs, regular sugar, chocolate chips Blue Brown
DNA Mutations • If a sentence states: • The ball is round. • A change in one letter can change the meaning of the sentence. • The hall is round. The same is true with genetics
DNA Mutation • Here is our gene again: GTA AGGC GCA TTC GTGA TGCA With a mutation our gene is changed! ATA AGGC GCA TTT GTGA TGCA Brown Blue Yellow Red