malaya
Uploaded by
13 SLIDES
315 VUES
130LIKES

Friday March 1, 2013

DESCRIPTION

Friday March 1, 2013. Warm Up: If there are 14 chromosomes in pea plant cells, how many chromosomes are present in a sex cell of a pea plant? AS: Brain Pop DNA. Unit III Genetics MYP Unit Question: How do you get the traits that you have? Area of Interaction: Human Ingenuity.

1 / 13

Télécharger la présentation

Friday March 1, 2013

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Friday March 1, 2013 Warm Up: If there are 14 chromosomes in pea plant cells, how many chromosomes are present in a sex cell of a pea plant? AS: Brain Pop DNA

  2. Unit IIIGeneticsMYP Unit Question: How do you get the traits that you have?Area of Interaction:Human Ingenuity

  3. Learning Target:Today we are learning the structure of DNA and how DNA molecules can be copied because DNA makes you who you are!

  4. DNA Structure What do deoxyribonucleic acids look like?

  5. DNA Structure DNA consists of 4 chemicals: Adenine = A Thiamine = T Guanine = G Cytosine = C

  6. These chemicals always pair together Adenine = A Thiamine = T Guanine = G Cytosine = C

  7. Double Helix DNA is in the form of a spiral staircase. This is called a Double Helix

  8. DNA Replication DNA replication occurs when the two sides of the DNA separate and unzip like a zipper.

  9. Two strands from one New DNA bases attach to the unzipped halves, to form new strands of DNA.

  10. DNA Replication This process must happen in cell division.

  11. DNA Mutations The DNA can be thought of as a recipe for proteins. The recipe can be long and looks like this: GTAAGGCGCATTCGTGATCGATCGGTA The recipe can be read like words: GTA AGGC GCA TTC GTGA TGCA The words can be read in sentences: GTA AGGC GCA TTC GTGA TGCA These sentences are called genes. A recipe for cookies would include: Flour, eggs, regular sugar, chocolate chips Blue Brown

  12. DNA Mutations • If a sentence states: • The ball is round. • A change in one letter can change the meaning of the sentence. • The hall is round. The same is true with genetics

  13. DNA Mutation • Here is our gene again: GTA AGGC GCA TTC GTGA TGCA With a mutation our gene is changed! ATA AGGC GCA TTT GTGA TGCA Brown Blue Yellow Red

More Related