mark-olsen
Uploaded by
25 SLIDES
843 VUES
290LIKES

Tuned Boyer Moore Algorithm

DESCRIPTION

Tuned Boyer Moore Algorithm. Fast string searching , HUME A. and SUNDAY D.M., Software - Practice & Experience 21(11), 1991, pp. 1221-1248. Adviser: R. C. T. Lee Speaker: C. W. Cheng National Chi Nan University. Problem Definition.

1 / 25

Télécharger la présentation

Tuned Boyer Moore Algorithm

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Tuned Boyer Moore Algorithm Fast string searching , HUME A. and SUNDAY D.M., Software - Practice & Experience 21(11), 1991, pp. 1221-1248. Adviser: R. C. T. Lee Speaker: C. W. Cheng National Chi Nan University

  2. Problem Definition Input: a text string T with length n and a pattern string P with length m. Output: all occurrences of P in T.

  3. Definition • Ts: the first character of a string T aligns to a pattern P. • Pl : the first character of a pattern P aligns to a string T. • Tj : the character of the jth position of a string T. • Pi : the character of the ith position of a pattern P. • Pf : the last character of a pattern P. • n :The length of T. • m : The length of P.

  4. Rule 2-2: 1-Suffix Rule (A Special Version of Rule 2) • Consider the 1-suffix x. We may apply Rule 2-2 now.

  5. Introduction • simplification of the Boyer-Moore algorithm. • uses only the bad-character shift. • easy to implement. • very fast in practice • uses Rule 2-2: 1-Suffix Rule

  6. Tuned Boyer Moore Algorithm • In this algorithm, We always focus on the last character of the window of T and try to slide the pattern to match the last character of T.

  7. Tuned Boyer Moore Algorithm Rule Since Ts+m-1≠ Pf , we move the pattern P to right such that the largest position i in the right of Pi is equal to Ts+m. We can shift the pattern at least (m-i) positions right until Ts+m-1= Pf. s s+m-1 i f 1 Shift i f 1 Shift 1 i f

  8. Tuned Boyer Moore Preprocessing Table • In this algorithm, we construct a table as follow. Let x be a character in the alphabet. We record the position of the last x, if it exists in P, we record the position of x from the second last position of P. If x does not exist in P1 to Pm-1, we record it as m.

  9. Tuned Boyer Moore Preprocessing Table • Example: 6 5 4 3 2 1 P=AGCAGAC

  10. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC

  11. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC tbmBC[A]=1, shift=1

  12. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC →

  13. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC tbmBC[G]=2, shift=2

  14. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC →

  15. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC match

  16. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC tbmBC[C]=4, shift=4 exact match

  17. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC →

  18. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC match

  19. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC tbmBC[C]=4, shift=4 mismatch

  20. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC →

  21. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC tbmBC[T]=7, shift=7

  22. Example • Text string T=GCGAGCAGACGTGCGAGTACG • Pattern string P=AGCAGAC →

  23. Time complexity • preprocessing phase in O(m+ σ) time and O(σ) space complexity, σ is the number of alphabets in pattern. • searching phase in O(mn) time complexity.

  24. Reference [KMP77] Fast pattern matching in strings, D. E. Knuth, J. H. Morris, Jr and V. B. Pratt, SIAM J. Computing, 6, 1977, pp. 323–350. [BM77] A fast string search algorithm, R. S. Boyer and J. S. Moore, Comm. ACM, 20, 1977, pp. 762–772. [S90] A very fast substring search algorithm, D. M. Sunday, Comm. ACM, 33, 1990, pp. 132–142. [RR89] The Rand MH Message Handling system: User’s Manual (UCIVersion), M. T. Rose and J. L. Romine, University of California, Irvine, 1989. [S82] A comparison of three string matching algorithms, G. De V. Smith, Software—Practice and Experience,12, 1982, pp. 57–66. [HS91] Fast string searching, HUME A. and SUNDAY D.M. , Software - Practice & Experience 21(11), 1991, pp. 1221-1248. [S94] String Searching Algorithms , Stephen, G.A., World Scientific, 1994. [ZT87] On improving the average case of the Boyer-Moore string matching algorithm, ZHU, R.F. and TAKAOKA, T., Journal of Information Processing 10(3) , 1987, pp. 173-177 . [R92] Tuning the Boyer-Moore-Horspool string searching algorithm, RAITA T., Software - Practice & Experience, 22(10) , 1992, pp. 879-884. [S94] On tuning the Boyer-Moore-Horspool string searching algorithms, SMITH, P.D., Software - Practice & Experience, 24(4) , 1994, pp. 435-436. [BR92] Average running time of the Boyer-Moore-Horspool algorithm, BAEZA-YATES, R.A., RÉGNIER, M., Theoretical Computer Science 92(1) , 1992, pp. 19-31. [H80] Practical fast searching in strings, HORSPOOL R.N., Software - Practice & Experience, 10(6) , 1980, pp. 501-506. [L95] Experimental results on string matching algorithms, LECROQ, T., Software - Practice & Experience 25(7) , 1995, pp. 727-765.

  25. Thanks for your listening

More Related