290 likes | 294 Vues
Chapter 17 – From Gene to Protein. One Gene – One Enzyme. Beadle and Tatum (1930s) Bombarded Neurospora (bread mold) with radiation to create mutants that could grow on different types of nutritional medium Created 3 classes of mutants which grew with different media
E N D
One Gene – One Enzyme • Beadle and Tatum (1930s) • Bombarded Neurospora (bread mold) with radiation to create mutants that could grow on different types of nutritional medium • Created 3 classes of mutants which grew with different media • Deduced each mutant was unable to carry out one step of the arginine pathway • Revised theory to One Gene – One Polypeptide (many enzymes are made up of multiple polypeptide chains.
Protein Synthesis: Overview • Transcription: • Synthesis of RNA under the direction of DNA (mRNA) • Occurs in the nucleus (of eukaryotes) • Translation: • Actual synthesis of a polypeptide under the direction of mRNA • Occurs in ribosomes • In eukaryotes – mRNA must be processed before translation can proceed
Protein Synthesis Challenge • Determine the amino acid sequence for the following DNA template: • TACCCTGCGTTAAGCTACCCAATT
The Triplet Code • The genetic instructions for a polypeptide chain are ‘written’ in the DNA as a series of 3-nucleotides called a codon • ‘U’ (uracil) replaces ‘T’ in RNA
Genetic Code • Each codon encodes for one amino acid • AUG = start codon or methionine • 3 stop codons = UAA, UAG, UGA
Transcription Unit and Terms • RNA polymerase: pries DNA apart and hooks RNA nucleotides together from the DNA code • Promoter region on DNA: where RNA polymerase attaches and where initiation of RNA begins • Terminator region: sequence that signals the end of transcription • Transcription unit: stretch of DNA transcribed into an RNA molecule
Transcription: Overview • Initiation – after RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis on the template strand • Elongation – the polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5’ to 3’ • Termination – RNA transcript is released, polymerase detaches, DNA completely reseals
Transcription: Initiation • Eukaryotic promoter region contains a TATA box, about 25 nucleotides upstream of start point • Transcription factors bind to TATA box, must occur before RNA polymerase II can attach • RNA polymerase II and additional transcription factors attach forming the initiation complex • Unwinds the DNA and RNA synthesis begins
Transcription: Elongation and Termination • Elongation: • Untwists DNA double helix, exposing 10 to 20 nucleotides • Adds nucleotides to growing 3’ end • Termination: • Transcription terminates when polymerase falls off (not exactly understood how in eukaryotes)
Transcription: Review • Transcription animation
Eukaryotic pre-mRNA structure • 5’ cap – modified guanine nucleotides, thought to function in protecting the reading sequence of DNA, facilitate movement of the mRNA out of the nucleus and aids in ribosome attachment • 3’ poly-A tail – 50-200 adenine molecules, similar functions as 5’ cap, protection, recognition, transport mRNA processing animation
Eukaryotic mRNA Modification • Exons – coding • Introns – non-coding • Must remove the introns from the pre-mRNA to create the mRNA transcript • snRNPs and proteins form spliceosome • Attaches at specific locations on pre-mRNA • RNA transcript is cut, introns removed, exons spliced together • animation
Evolutionary Significance • So what is the biological function of an intron? • Some introns control gene activity in some way • Some introns may be exons, alternative RNA splicing • Multiple domains in one gene • Could lead to evolution of new exons (exon shuffling)
Translation: basic concept • mRNA is moved through a ribosome • Codons are translated into an amino acid sequence, one by one • tRNA molecules bring the amino acids to the ribosomes • Creation of a polypeptide chain
tRNA Structure • Carry amino acids to the ribosomes for translation • Anticodon • 3’ AA attachment site
tRNA Production • Aminoacyl-tRNA synthetase binds an amino acid to its specific tRNA molecule • When attached called an aminoacyl-tRNA • 20 different synthetases, one for each amino acid • 45 different tRNA molecules, but 61 different RNA codons, how is this possible? • 3rd base in anticodon can bond to multiple codons • For example, U can pair with both A and G in 3rd position of tRNA, also some tRNA have inosine (a purine) in the 3rd position which can pair with A, U, or C
Ribosome Structure • Composed of rRNA and protein • Each ribosome has 2 subunits, small and large • Small subunit has mRNA binding site • Large subunit has 3 tRNA binding sites: P (peptidyl-tRNA site), A (aminoacyl-tRNA site), and E (exit site).
Translation: Initiation • mRNA binds to small ribosomal subunit • Initiator tRNA attaches to the start codon AUG • Large subunit attaches with initiator tRNA in p site, uses energy in GTP
Translation: Elongation • The anticodon of an incoming aminoacyl-tRNA base-pairs with the complementary mRNA codon in the A-site • Large subunit catalyzes the formation of a peptide bond between the amino acids attached to the tRNA in both the P and A sites • The growing polypeptide chain is transferred to the tRNA in the A site • The ribosome translocates, moving the “naked” tRNA to the E site for removal, exposing the A site for the next tRNA
Translation: Termination • When ribosome reaches stop codon, ribosome accepts a release factor protein • Hydrolyzes the bond between the tRNA in the P site and the last amino acid in the chain • The 2 subunits and other components dissociate
Translation: Review • Translation animation
Polyribosomes (or polysomes) • Takes approximately a minute to make an average size polypeptide chain • Can have multiple ribosomes on the same mRNA chain • Enable cell to make many copies of a protein very quickly
Polypeptides and the ER • Proteins destined for export need to be moved through the endomembrane system • Growing polypeptide chain (in cytosol) will have a signal peptide sequence • Signal recognition particle (SRP) guides ribosome to ER
Point Mutations • Mutations are changes in the genetic material of a cell • Point mutations are changes in just one base pair • Can cause genetic disorders, ex. Sickle cell
Types of Point Mutations • Base-pair substitution – the replacement of one nucleotide for another • Silent – no effect • Missense – still codes for an amino acid, but the wrong one • Nonsense – stop codon, premature termination
Other Types of Mutations • Insertions and deletions – additions and losses of nucleotide pairs in a gene, usually more of a problem than substitutions • Frameshift mutations – when the number of nucleotides inserted or deleted is not a multiple of 3, shifts the codon reading frame, can either be missense or nonsense • Mutagen – chemical or physical agent that causes a mutation