1 / 43

Genes and human history

Genes and human history. Gil McVean, Department of Statistics, Oxford. Contact: mcvean@stats.ox.ac.uk. Where does the variation come from? How old are the genetic differences between us? Are these differences important?. How different are our genomes?. Rabbit. Anti-A antibodies. B. O.

melina
Télécharger la présentation

Genes and human history

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genes and human history Gil McVean, Department of Statistics, Oxford Contact: mcvean@stats.ox.ac.uk

  2. Where does the variation come from? • How old are the genetic differences between us? • Are these differences important?

  3. How different are our genomes?

  4. Rabbit Anti-A antibodies B O AB A Serological techniques for detecting variation Human A

  5. Blood group systems in humans • 28 known systems • 39 genes, 643 alleles http://www.bioc.aecom.yu.edu/bgmut/summary.htm

  6. Protein electroporesis • Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected • In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different Starch or agar gel - + - - + + - - + - - - - - - + + - - - Direction of travel Lewontin and Hubby (1966) Harris(1966)

  7. The rise of DNA sequencing GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCCCGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGTGAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATATAAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCTAAGCCATTCCAACGAGGCTTTCGTAACCAAATCAGTTCTTCCCAGTCCAGATGAGGCGAACGTAGGTGCTGTTGGAACCATGAGTGGCCAACAGAATACTGTGGATGCTAAGCTAATGGAATGTGTTAATCAGACGTTTGCTGATGTGACACATTGGTCGCTGCTCTTTGATGCGGAAATCTATGAGCGGTCAAACCGATACAAACCCGGCTATGTCGTTCGCACAACAGTCGGGTCCCACCCCATTGTTCTTATGAAGGTATTACTGGTCATACGATGCTTTTGCGACGCATCCCTCCCTATGACGAGAGTGCAGTCAGACCCCTCGACCATTTCCCTTAGAAAGACCACCCATCTCTTCAAAGTTATTCTCCGTGACATGCGAACGCTGAAGGATAAGGAGCGGCATGCAGACTTTTATGTGTGCTCTCTGCTGGTCCAGCGGCATCTAAACGTCTCATCACTAGGGCCACGCAGTCGTTTTTAAGAGGCTCTATTTTTACTAATTATTCTTGTCCACCACGACCTCTCAGCGCGGCAGATAGGTTCACAGGCTAGCGTCGGGTAATGCATTGCAGTTTCGTTACTCGTTCAGACAAGACTCGATGCTTTACACTCACGACCCGCAAAGCCTTGGCCTTACAAGGGTATTAGGCCGAACACTTACTTATCGCCGAAGGTACGTCGGCTATTGTAGCCCAAACCCTAGACTGAGCCCTAACCTCTACGCGTATCTTATAGGTTCAGAACGCCGAAGGACTATTCTCACGGCATTCATGGTTAAAAGAGAGTCGAGGCGCCTGCTATATGTGCCGAGTCCCATTAGTCAGTACACTTGCCATCACATTTGTCCTGTTAGGCGGACACTTAGAGTAAGCGTACAACGCCTTACAACGAGACGCAGATCGCTTTTCTAATTGCGCCGCGTCTCTACCATCGTGGCCAGTTCATACTCACACGGAGGTGTGCAACCCGTAACACGAGTGAGTGCTCACTTTATAATAAGTCAGCGTTCAGGACTGAGTGCAACCAATCTACGCCAGGAATCGCAAACAGCGCTCATAAACTTCTTACCTTTCCATAGCGCGCCTTTCGAGTATTATTGACCGTTAGGACTACGATAGGCTTCGACAATAGACCCTATCTGCGCATCATTACCTCTCACCGGGGGAAAGAAATTCCAATCAATCTGTCCAGGGCGCCCGTTTTTTTAAGACCTTAGTGCCCATGAATGAACTGGCTCAAGCAATAGCGGCTGCTCGTGCCATGCGTGAGCTGGCGGCCAAATCGGACTCACGGACAAGTCTGCCCCCTTGTGAGTTAGTGTTGGCTTGACAACTCTAAAGTCCGAACCCATCGTGCGGCCATCCTACGTGGTGTAGCTTTGGCCCATAACTAACCTGGTTACTCACTATCCTGCGACTCGTCTGGTCTCACTAGGCGATTCCCCCCGGCTTCGTATTGCAACATTCTAACGAATGCGAAGTCAAACAGTCCAGCTTAACAAAGGGGTCTTGACGAGACTCTGTAATCGTCTGCTAGCCCCGGACTCTGTTGTCGAAGGCAATTTGACGACCCACACGAGGTGCAGACGTAGTCAGGCCTGATAGCTATGTATGCAGGCATATCCCTATAAAGTAGCGTTTGGTTATCCTACCATTAGCCGTTTCCGCATCTACCAGTGTCGACCGG

  8. SNPs GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCCCGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGTGAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATATAAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCTAAGCCATTCCAACGAGGCTTTCGTAACCAAATCAGTTCTTCCCAGTCCAGATGAGGCGAACGTAGGTGCTGTTGGAACCATGAGTGGCCAACAGAATACTGTGGATGCTAAGCTAATGGAATGTGTTAATCAGACGTTTGCTGATGTGACACATTGGTCGCTGCTCTTTGATGCGGAAATCTATGAGCGGTCAAACCGATACAAACCCGGCTATGTCGTTCGCACAACAGTCGGGTCCCACCCCATTGTTCTTATGAAGGTATTACTGGTCATACGATGCTTTTGCGACGCATCCCTCCCTATGACGAGAGTGCAGTCAGACCCCTCGACCATTTCCCTTAGAAAGACCACCCATCTCTTCAAAGTTATTCTCCGTGACATGCGAACGCTGAAGGATAAGGAGCGGCATGCAGACTTTTATGTGTGCTCTCTGCTGGTCCAGCGGCATCTAAACGTCTCATCACTAGGGCCACGCAGTCGTTTTTAAGAGGCTCTATTTTTACTAATTATTCTTGTCCACCACGACCTCTCAGCGCGGCAGATAGGTTCACAGGCTAGCGTCGGGTAATGCATTGCAGTTTCGTTACTCGTTCAGACAAGACTCGATGCTTTACACTCACGACCCGCAAAGCCTTGGCCTTACAAGGGTATTAGGCCGAACACTTACTTATCGCCGAAGGTACGTCGGCTATTGTAGCCCAAACCCTAGACTGAGCCCTAACCTCTACGCGTATCTTATAGGTTCAGAACGCCGAAGGACTATTCTCACGGCATTCATGGTTAAAAGAGAGTCGAGGCGCCTGCTATATGTGCCGAGTCCCATTAGTCAGTACACTTGCCATCACATTTGTCCTGTTAGGCGGACACTTAGAGTAAGCGTACAACGCCTTACAACGAGACGCAGATCGCTTTTCTAATTGCGCCGCGTCTCTACCATCGTGGCCAGTTCATACTCACACGGAGGTGTGCAACCCGTAACACGAGTGAGTGCTCACTTTATAATAAGTCAGCGTTCAGGACTGAGTGCAACCAATCTACGCCAGGAATCGCAAACAGCGCTCATAAACTTCTTACCTTTCCATAGCGCGCCTTTCGAGTATTATTGACCGTTAGGACTACGATAGGCTTCGACAATAGACCCTATCTGCGCATCATTACCTCTCACCGGGGGAAAGAAATTCCAATCAATCTGTCCAGGGCGCCCGTTTTTTTAAGACCTTAGTGCCCATGAATGAACTGGCTCAAGCAATAGCGGCTGCTCGTGCCATGCGTGAGCTGGCGGCCAAATCGGACTCACGGACAAGTCTGCCCCCTTGTGAGTTAGTGTTGGCTTGACAACTCTAAAGTCCGAACCCATCGTGCGGCCATCCTACGTGGTGTAGCTTTGGCCCATAACTAACCTGGTTACTCACTATCCTGCGACTCGTCTGGTCTCACTAGGCGATTCCCCCCGGCTTCGTATTGCAACATTCTAACGAATGCGAAGTCAAACAGTCCAGCTTAACAAAGGGGTCTTGACGAGACTCTGTAATCGTCTGCTAGCCCCGGACTCTGTTGTCGAAGGCAATTTGACGACCCACACGAGGTGCAGACGTAGTCAGGCCTGATAGCTATGTATGCAGGCATATCCCTATAAAGTAGCGTTTGGTTATCCTACCATTAGCCGTTTCCGCATCTACCAGTGTCGACCGG Nucleotide Polymorphisms Single TGCATTGCGTAGGC TGCATTCCGTAGGC 1 in 1000 between any two genomes

  9. Different, but not that different • Humans are one of the least diverse organisms

  10. c. 3,000,000 SNPs in 270 people

  11. c. 40,000,000 SNPs in 1000 people

  12. How do we differ? – Let me count the ways • Single nucleotide polymorphisms • Short indels (=insertion/deletion) • Microsatellite (STR) repeat number • Minisatellites • Repeated genes • rRNA, histones • Large inversions, deletions • Y chromosome, Copy Number Variants (CNVs) TGCATTGCGTAGGC TGCATTCCGTAGGC TGCATT---TAGGC TGCATTCCGTAGGC TGCTCATCATCATCAGC TGCTCATCA------GC ≤100bp 1-5kb

  13. Y chromosome variation • Non-pathological rearrangements of the AZFc region on the Y chromosome

  14. Copy-number variation in genes • Variation in gene number can contribute to phenotypic variation Perry et al. 2007

  15. Where does genetic variation come from? • You will pass on about 60 new mutations to each of your children • Most of these are destined to die out within a few generations • Most variation is inherited from our ancestors

  16. Me You

  17. Mutations in our ancestors Our genealogical tree Our genomes Inherited mutations

  18. mtDNA Eve Vigilant et al. (1991)

  19. Recombination means that different parts of the genome have different tree • Looking back in time, recombination means that different parts of your chromosomes follow different evolutionary paths • This means that the genealogical tree will change along the genome Grandmaternal sequence Grandpaternal sequence x TCAGGCATGGATCAGGGAGCT TCACGCATGGAACAGGGAGCT TCAGGCATGG AACAGGGAGCT

  20. How old?

  21. Human – chimp split Autosomal MRCA Origin of H. sapiens

  22. Homo erectus

  23. Australopithecus afarensis

  24. Ancient variation in the human genome I • Inversion on chromosome 17 (Stefansson et al 2005)

  25. Ancient variation in the human genome II • Trans-specific polymorphism in the HLA Lawlor et al. 1988 , Horton et al (1998)

  26. Did early humans breed with Neanderthals? Neanderthals mtDNA sequences say no… Ovchinnikov et al (2000)

  27. But… • There is some evidence for this in the presence of unusual haplotypes found in Europe composed of SNPs not found in non-European populations Plagnol and Wall (2006)

  28. What are the genetic differences that make us human?

  29. Chromosomal changes • Human chromosome 2 is a fusion of two chromosomes in great apes • There are several inversion differences between the chromosomes Feuk et al (2005)

  30. Gene loss • Loss of enzymes that make sialic acid • Sugar on cell surface that mediates a variety of recognition events involving pathogenic microbes and toxins • Myosin heavy chain • Associated with gracilization Wang et al (2006)

  31. Gene evolution • FOXP2 is a highly conserved gene (across the mammalia), expressed in the brain. Mutations in the gene in humans are associated with specific language impairment • Across the entire mammalian phylogeny, there have only been a very few amino acid changing substitutions • However, two amino acid changes have become fixed in the lineage leading to modern humans since the split with the chimpanzee lineage Enard et al. (2002)

  32. Are the genetic differences between people and peoples important?

  33. Infectious disease Diet Genome ? Physical environment Mating success

  34. Detecting recent adaptive evolution • Let’s look closely at the dynamics of the fixation process for adaptive mutations • The fixation of a beneficial mutation is associated with a change in the patterns of linked neutral genetic variation • This is known as the hitch-hiking effect (Maynard Smith and Haigh 1974) • Looking for the signature of hitch-hiking can be a good way of detecting very recent fixation events

  35. Lactose persistence

  36. Lactose intolerance

  37. Skin pigmentation

  38. Lamason et al. (2005)

  39. Disease resistance • Mutations in the Duffy gene associated with protection again malarial infection (Plasmodium vivax)

  40. Evidence for widespread local adaptation Protein-changing Protein unchanging The International HapMap Consortium (2007)

  41. Classes of selected genes Voight et al. (2005)

  42. Reading • Human genetic variation • Rosenberg et al. Genetic structure of human populations. Science 2002, 298:2381-2385. • Conrad et al. A worldwide survey of haplotype variation and linkage disequilibrium in the human genome. Nature Genet. 2006, 1251-1260. • McVean et al. Perspectives on human genetic variation from the International HapMap Project. PLoS Genetics 2005, 1:e54. • The origin of modern humans • Reed & Tishkoff. African human diversity, origins and migrations. Curr Opin Genet Dev. 2006 16:597-605. • Jobling et al. Human evolutionary genetics: origins, peoples, and disease.Garland Science, 2004. • Harding & McVean. A structured ancestral population for the evolution of modern humans. Curr. Op. Genet. Dev. 2004, 14: 667-674. • Natural selection • Lamason et al. SLC24A5, a putative cation exchanger, affects pigmentation in zebrafish and humans. Science 2005, 310:1782-1786. • Sabeti et al. Positive natural selection in the human lineage. Science 2006, 312:1614-1620. • Tishkoff et al. Convergent adaptation of human lactase persistence in Africa and Europe. Nat Genet. 2007 39:31-40

More Related