mendel
Uploaded by
78 SLIDES
1022 VUES
790LIKES

Genomes & their evolution

DESCRIPTION

Genomes & their evolution. Campbell & Reece Chapter 21. Genomics . study of a specie’s whole set of genes & their interactions bioinformatics : use of computers, software, & mathematical modes to process & integrate biological informationfrom large data sets. Human Genome Project.

1 / 78

Download Presentation
Télécharger la présentation

Genomes & their evolution

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genomes & their evolution Campbell & Reece Chapter 21

  2. Genomics • study of a specie’s whole set of genes & their interactions • bioinformatics: use of computers, software, & mathematical modes to process & integrate biological informationfrom large data sets

  3. Human Genome Project • sequencing the human genome • 1990 – 2003 • 20 large centers in 6 countries + many other small labs working on small parts of it

  4. FISH Cytogenetic Map: chromosome banding pattern & location of specific genes by flourescence in situ hybridization (FISH) • b/4 Human Genome Project the # of chromosomes & their banding patterns known for many species • some human genes already located

  5. FISH • method in which flourescently labeled nucleic acid probes allowed to hybridize to immobilized array of whole chromosomes • maps generated from this used as starting point

  6. 3 Stages to Genome Sequencing • Linkage Mapping • Physical Mapping • DNA Sequencing

  7. Linkage Mapping • ordering of genetic markers (1000’s) spaced thru-out chromosomes • order & spacing determined by recombinant frequencies • markers: genes, RFLPs, (restriction fragment length polymorphism) or STRs (short tandem repeats)

  8. RFLP • in gel electrophoresis, fragments of DNA are separated by length • (-) charge of phosphate groups moves DNA thru gel (acting like a sieve) toward (+) end • resulting in: bands that each consist of thousands of DNA molecules of same length

  9. RFLP • 1 useful technique has been to apply restriction fragment analysis to these bands  information about DNA sequences • restriction enzymes “cut” DNA at known nucleotide sequences then these fragments produced are put thru gel electrophoresis

  10. RFLP • DNA can be recovered undamaged from gel bands (so can be used to prepare pure sample of individual fragments) • can be used to compare 2 different DNA molecules (2 alleles of same gene) if nucleotide sequence affects a restriction site: change in even 1 nucleotide will prevent the “cut”

  11. RFLP (restriction fragment length polymorphism) • polymorphisms: variations in DNA sequence among a population • this particular type of sequence change is called RFLP (“rif-lip”) • if 1 allele contains a RFLP, digestion with the enzyme will produce a fragment of different length

  12. Short Tandem Repeats: STR • technique used by forensic scientists • are tandemly repeated units of 2 to 5 base sequences in specific regions of the genome • # repeats present is highly variable person to person (polymorphic) • 1 individual’s may vary if has 2 alleles

  13. STR • PCR (polymerase chain react is used to amplify particular STRs • quicker technique than RFLP analysis • can be used with less pure samples of DNA or if only have minute sample

  14. PCR

  15. 3 Stages to Genome Sequencing • Linkage Mapping • Physical Mapping • DNA Sequencing

  16. Physical Mapping • ordering of large fragments cloned in YAC & BAC vectors • followed by ordering of smaller fragments cloned in phage & plasmid vectors • key is to make overlapping fragments & then use probes or automated nucleotide sequencing of ends to find the overlaps

  17. YAC & BAC Yeast Artificial Chromosome Bacterial Artificial Chromosome • 1st cloning vector • carries inserted fragments million base pairs (bp) long • carries inserts of 100,000 – 300,000 bp

  18. Physical Mapping • fragments from YAC & BAC put in order • each fragment cut into smaller pieces • which are then cloned in plasmids, ordered, & finally sequenced

  19. DNA Sequencing • determination of nucleotide sequence of each small fragment & assembly of the partial sequences into the complete genome sequence • for human genome used sequence machines • sequencing of all 3 billion bps in haploid set of human chromosomes done at rate 1,000 bp/s

  20. Human Genome Project • took 13 yrs • $100 million

  21. Sequencing an Entire Genome

  22. Whole-Genome Shotgun Approach • essentially skips the linkage mapping & physical mapping stages & starts with sequencing of DNA fragments from randomly cut DNA • computers then assemble the resulting very large # of short sequences into a single continuous sequence

  23. Shotgun Approach

  24. Application of Systems Biology to Medicine • 2007 – 2010 set out to find all the common mutations in 3 types of cancer (lung, ovarian, glioblastoma) by comparing gene sequences & patterns of gene expression in cancer cells compared to normal cells

  25. Cancer Genes • # genes identified that had been suspect + genes that were not suspected • gives researchers point to develop new treatments aimed specifically @ these genes • 10 more cancers then studied (most common/most lethal)

  26. Microarray Chip

  27. Genomes Vary in Size, # of Genes, & Gene Density

  28. # of Genes • Prokaryotic cells < Eukaryotic cells • Humans: expected 50,000 – 100,000 but have found < 30,000 • How do we get by with not many more genes than nematodes? • # proteins we have > # genes • vertebrates use alternative splicing of RNA transcripts

  29. Gene Density • # genes in given length of DNA • eukaryotes generally have larger genomes but fewer genes in given # of bps • humans have 100’s – 1000’s times more bps but only 5 – 15 times as many genes • Sooooo: gene density lower in humans than in bacteria

  30. Noncoding DNA • includes most of eukaryotic DNA • introns • most is noncoding DNA between genes

  31. 1.5% of our genome codes for proteins, or is transcribed into rRNA or tRNA

  32. Pseudogenes • former genes that have accumulated over a long time & no longer produce functional proteins

  33. Repetitive DNA • sequences that are present in multiple copies in the genome • 75% of this repetitive DNA (44% of entire genome) is made up of units called transposable elements & related sequences

  34. Transposable Elements & Related Sequences • found in both prokaryotes & eukaryotes • stretches of DNA that can move from one location to another w/in the genome • transposition: process where 1 transposable element moves from 1 site to different target site by a type of recombination process

  35. “Jumping” Genes

  36. Transposons • Gene that is “jumping” never actually completely detach from the cell’s DNA • original and new strands brought together by enzymes & other proteins that bind to DNA • 1st evidence came from studying genetics of Indian corn

  37. Movement of Transposons & Retrotransposons • 2 types of eukaryotic transposons: • Transposons • move w/in genome by means of DNA intermediate • move & paste or cut & paste • both require enzyme transposase(encoded by transposon)

  38. Retrotransposon • 2nd type of eukaryotic transposable element • move by means of RNA intermediate that is a transcript of retrotransposon DNA • always leave copy @ original site during transposition • RNA intermediate is converted back to DNA by reverse transcriptase (enzyme encoded by retrotransposon)

  39. Other Repeating DNA • probably arises due to mistakes made during DNA replication or recombination • ~14% human DNA • ~1/3 of this duplications of long stretches of DNA • segments copied from 1 chromosomal location to another on same or different chromosome

  40. Simple Sequence DNA • Contains many copies of tandemly repeated short sequences: • ATTGCGATTGCGATTGCGATTGCG • repeated units can be 2 – 500 nucleotides

  41. Short Tandem Repeat (STR) • repeating units that are 2 to 5 nucleotides long • found on telomeres & centromeres (so may play structural role) • # of repeating units can vary w/in same genome and with different alleles • this diversity means STR’s can be used in preparing genetic profiles

  42. Other Types of DNA • 1.5% of genome: genes that code for proteins, rRNA, tRNA • include introns & regulatory sequences associated with genes total amt is 25% of the human genome

  43. Multigene Families • <1/2 genes present in 1 copy • multigene families: collections of 2 or more identical or very similar genes • some identical present in tandem, repeats code for an RNA or histone proteins

  44. rRNA genes • repeated tandemly 100’s to 1000’s times in 1 to several clusters in genomes of multicellular eukaryotes • helps cells quickly make millions of ribosomes necessary for protein synthesis

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer