michael-warren
Uploaded by
62 SLIDES
954 VUES
620LIKES

Microbial Genetics

DESCRIPTION

Microbial Genetics. Biotechnology. A Study of Genetics. Genetics The science of heredity that is concerned with: Transmission of characteristics The nature and function of DNA Patterns of heredity variation within populations and the changes in these patterns. Before we knew about DNA…

1 / 62

Télécharger la présentation

Microbial Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Microbial Genetics Biotechnology

  2. A Study of Genetics Genetics The science of heredity that is concerned with: • Transmission of characteristics • The nature and function of DNA • Patterns of heredity variation within populations and the changes in these patterns.

  3. Before we knew about DNA… You observe that children look similar to their parents, families share characteristics, but often there are new traits that are created. You’ve never heard of DNA, cells, genes… How do you explain inheritance?

  4. Gregor Mendel Charles Darwin Mid 1800s inheritance of Natural Selection genetic traits

  5. Miescher 1869 • Isolated something he called ‘Nuclein’ from white blood cells • Determined that it was composed of: • Sugar, phosphate, and nitrogen • Found that it was weakly acidic • Renamed this substance: Nucleic Acid “DNA Extraction”

  6. 1940s • Chromosomes are made of DNA and proteins • Chromosomes carried our hereditary material • Didn’t know if the proteins or the DNA was the hereditary material • Protein was considered most likely because of its complexity and diversity • DNA is only: sugar, phosphate, nitrogen and 4 bases • Protein is combinations of 20 amino acids

  7. 1944 Griffiths’ Experiment(utilized Streptococcus pneumoniae) Avirulent strain grows as rough colonies Virulent strain grows as smooth colonies

  8. Griffiths’ Experiment Continued PROVED THAT TRAITS ARE TRANSFERRED FROM ORGANISM TO ORGANISM

  9. Griffiths Summary • R cells avirulent, S Cells virulent • Heat-killed S cells avirulent • [R cells (avirulents) + Heat-killed S Cells (avirulent) = VIRULENCE • Live S cells in blood • Transfer of some substance from dead S cells to live R cells • “Transforming Principle” Traits can be transferred from one organism to another!

  10. DNA or Protein??1952 Hershey and Chase

  11. Hershey-Chase Experiment • Grew bacteria in presence of either radioactive sulfur (35S) to label proteins (methionine and cysteine) or radioactive Phosphorous (32P) to label DNA • Infected with bacteriophage, let growth and lysis occur, bacteriaphage particles now labeled with 35S or 32P

  12. Evidence that DNA is the hereditary Material Remember: 35S labeled protein 32P labeled DNA

  13. 1953 Watson, Crick and Franklin

  14. Two types of Nucleic AcidDNA: deoxyribonucleic acid RNA: ribonucleic acid Both are polymers of nucleotides: P Base Sugar Nucleotide

  15. DNA • 5 carbon deoxyribose sugar • Four bases:

  16. RNA • 5 carbon ribose sugar • Single stranded (ss) • Four Bases:

  17. The DNA Double Helix Sugar phosphate backbone Nitrogenous bases

  18. Right Handed Helix Major groove Minor groove Proteins fit into these grooves when they interact

  19. Purines and Pyrimidines Double ring structures Single ring structures

  20. DNA Basepairs

  21. Base pairing

  22. Joining Nucleotides • Nucleotides grow by addition to the 3’ carbon (the 3’ end) • 3’-5’ phosphate bond

  23. Writing DNA Sequences DNA is always written in the 5’ to 3’ direction: 5’  3’ 5’ ATCCGCTAACTTAGGCTTACG 3’ Abbreviate the nucleotides by using the first letter of each base

  24. DS DNA Antiparallel 5’ ATCCGACTATCGCGGAAT 3’ 3’ TAGGCTGATAGCGCCTTA 5’ Complimentary Bases A=T (double bond) C=G (triple bond, stronger bond) Two bases joined together is a Base Pair

  25. New DNA New DNA

  26. DNA Replication is a Semi-conservative process

  27. Matching of DNA Bases in DNA Replication 5’ 3’ ATTCGATCTAG 5’ 3’ A G T A G C T A A T C

  28. Requirements for DNA Replication • Template DNA • A, T, C, G Nucleotides • DNA polymerase • primers • Ligase • Helicase

  29. Steps in Replication • Unwinding of the double helix- Helicase • Synthesis of short RNA sequences called Primers on lagging strand • DNA polymerase adds bases onto the 3’ end of the primers • Proofreading • Ligase forms covalent bonds between nucleotides from lagging strand segments

  30. Half of a replication bubble is a replication fork DNA Replication can be bidirectional in bacteria Replication fork Replication fork

  31. Original

  32. The Central Dogma DNA mRNA  Protein

  33. DNA DNA DNA mRNA Protein Transcription Replication Translation

  34. Types of RNA Used in Translation • rRNA • Ribosomal RNA, 2 subunits join to make one functional rRNA • tRNA • Transfer RNA, clover leaf shape, carries amino acids to the growing amino acid chain Amino acid attaches here Anticodon Attaches to mRNA

  35. Amino Acids (A.A.) • A chain of amino acids = a protein • There are 20 different amino acids • They have an amino (NH2) group and a carboxyl (COOH) group • The basic structure for an amino acid is at right. A different element or group of elements is in place of the R, this is what makes each A.A. different Amino group (N terminal end) Carboxyl group (C terminal end)

  36. The Steps of TranslationmRNA  Amino Acid chain=protein) • Initiation • Elongation • Termination Codon: every 3 bases = a codon=1 amino acid 5’ AUGCGCCGAUUCAGA 3’ The Start codon establishes the Reading Frame

  37. Step 1: Initiation • The ribosome attaches near the 5’ end of the mRNA at the Start Codon AUG AUG codes for the amino acid, Methionine (Met) 5’ AUGCGCCGAUUCAGAACGUUCGA 3’ Multiple ribosomes can attach to an mRNA strand at any one time

  38. Step 2: Elongation 5’ AUGCGCCGAUUCUGAACGUUCGA 3’ AAG UAC Phe GCG GCU CUA Met Arg Arg Asp

  39. Step 2: Elongation cont. 5’ AUGCGCCGAUUCUGAACGUUCGA 3’ UAC GCG AAG GCU Met Arg Phe Arg Only 2 tRNAs can be attached to the mRNA at any one time

  40. Step 2: Elongation cont. 5’ AUGCGCCGAUAAUGAACGUUCGA 3’ GCU GCG AAG Met Arg Arg Phe

  41. Step 3: Termination • Stop codons AUGCGCCGAUUCUGAACGUUCGA 3’

  42. Mutation • Change in the genetic material • Mutations may be neutral, beneficial, or harmful • Mutagen: Agent that causes mutations • Spontaneous mutations: Occur in the absence of a mutagen

  43. Mutation • Change in one base • Result in change in amino acid • Base substitution (point mutation) • Missense mutation Figure 8.17a, b

  44. Mutation • Results in a nonsense codon • Nonsense mutation Figure 8.17a, c

  45. Mutation • Insertion or deletion of one or more nucleotide pairs • Frameshift mutation Figure 8.17a, d

  46. Mutation • Ionizing radiation (X rays and gamma rays) causes the formation of ions that can react with nucleotides and the deoxyribose-phosphate backbone. • Nucleotide excision repairs mutations

  47. Mutation • UV radiation causes thymine dimers • Light-repair separates thymine dimers Figure 8.20

More Related