1 / 21

INDM 3007 Gene expression in eukaryotes

INDM 3007 Gene expression in eukaryotes. Transcription. Translation. Gene expression in prokaryotes. Protein. RNA. Transcription. Translation. NUCLEUS. RNA. G. AAAAA(n). G. AAAAA(n). Gene expression in eukaryotes. Capping, Splicing PolyA addition. CYTOPLASM.

miron
Télécharger la présentation

INDM 3007 Gene expression in eukaryotes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. INDM 3007 Gene expression in eukaryotes

  2. Transcription Translation Gene expression in prokaryotes Protein RNA

  3. Transcription Translation NUCLEUS RNA G AAAAA(n) G AAAAA(n) Gene expression in eukaryotes Capping, Splicing PolyA addition CYTOPLASM

  4. Eukaryotic genomes consist of a number of chromosomes Individual chromosomes contain single linear DNA molecules. These are replicated bidirectionally from many origins. Centromeres function in chromosome segregation during cell division. Telomeres stablise the ends.

  5. Genome sizes OrganismGenome sizeNo. of genes. (Mb) E. coli 4.64,288 S. cerevisiae 13.56,034 A. thaliana 100 25,498 (Cress) D. melanogaster 165 13,601 H. sapiens 4000 <40,000 Amphiuma sp. 76,500 <40,000 (Salamander)

  6. The genomic DNA of higher eukaryotes contains vast amounts of non-coding DNA. Only 2% of the human genome codes for proteins. 95% has no known function. The excess DNA includes many types of repeated sequences. [30% of the human genome is non-functional repetitive DNA]

  7. Repetitive DNA Highly repetitive Moderately repetitive Satellite DNA Tandem repeats Interspersed repeats (retrotransposons) Multicopy genes Minisatellites Microsatellites SINES LINES rRNA genes VNTRs Dinucleotide repeats

  8. Satellite DNA consists of hundreds of tandem repeats of AT-rich sequences that are170 to 250 bp in length. These are not transcribed and are often located near centromeres.

  9. Interspersed repeated sequences dispersed throughout the genome 100s and 1000s of individual copies Short interspersed nucleotide repeats (SINES) are 100 to 500 bp in length. Long interspersed nucleotide repeats (LINES) are several kilobases in length. The functions of SINES and LINES are unknown. Many are transcribed into long or short RNA transcripts.

  10. Mini-satellite DNA - is like satellite DNA but contains fewer copies of the repeat sequence. - is useful in DNA fingerprinting.

  11. DNA fingerprinting Cleavage with restriction enzymes Southern hybridisation 1 2 3 4 6 4 3 2 Probe Parent 1 6 3 Parent 2 Parents Offspring 1 2 4 2

  12. Centromeres Centromeres function in binding microtubules that pull sister chromatids towards opposite poles of the cell. Centromeres are variable in different species. They range in size from 40 to 600 kb. S. cerevisiae has exceptionally small centromeres.

  13. S. cerevisiae centromere DNA TCACATGATGATATTTGATTTTATTATATTTTTAAAAAAAGTAAAAAATAAAAAGTAGTTTATTTTTAAAAAATAAAATTTAAAATATTTCACAAAATGATTTCCGAA AGTGTACTACTATAAACTAAAATAATATAAAATTTTTTTTCATTTTTTATTTTTCATCAAATAAAAATTTTTTATTTTAAATTTTATAAAGTGTTTTACTAAAGGCTT CDE-1 CDE-II 80 – 90 bp, > 90% A + T CDE-III Proteins that bind the S. cerevisiae centromere have been identified.

  14. Replicating the ends of linear chromosomes 5’ 3’ Leading strand Lagging strand 5’ 3’ DNA replication complex can’t make RNA to prime synthesis of 5’ end of lagging strand. Chromosomes would get shorter after every duplication.

  15. TTGGGG 3’AACCCCAACCCC 5’ TTGGGG TTGGGG TTGGGG TTGGGG 3’ Telomerase uses an RNA template to add repeats to the 3’ ends. Telomere repeat sequences vary with species. The consensus for the CA strand is Cn (A / T) m ; n > 1, m is 1 to 4 .

  16. TTGGGG TTGGGG TTGGGG TT The complementary strand is synthesised, possibly primed by a hairpin. 3’ TTGGGG TTGGGG TTGGGG TTGGGG TTGGGG TTGGGG TTGGGG TTGGGG

  17. In some species, Hoogstein base-pairing folds back the 3’ end of the telomere into an unusual hairpin structure. This unusual base-pairing forms G-quartets. It is not known whether these structures form in vivo .

  18. Centromeres can also form D loops. The TRF2 protein catalyses D loop formation. This protects the chromosome end.

  19. Loop is 5 – 10 kb in length.

  20. Yeast artificial chromosomes (YACs) are useful for cloning large fragments of DNA.

More Related