mohawk
Uploaded by
21 SLIDES
353 VUES
210LIKES

BioLogic

DESCRIPTION

BioLogic. The Project. A Bacterial Decoder Uses biologically modeled ‘logic gates’ to essentially decode functions Function outputs will rely on specificity of the combination of input(s) Outputs will be regulated at the transcriptional level. Bacterial Decoder. Combinations. output.

1 / 21

Télécharger la présentation

BioLogic

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. BioLogic

  2. The Project • A Bacterial Decoder • Uses biologically modeled ‘logic gates’ to essentially decode functions • Function outputs will rely on specificity of the combination of input(s) • Outputs will be regulated at the transcriptional level

  3. Bacterial Decoder Combinations output 3 - Glucose, Lactose CFP 2 - Glucose, No Lactose BFP 1 - No Glucose, Lactose YFP GFP 0 - No Glucose, No Lactose inputs A B Glucose/No Glucose 1/0 Lactose/No Lactose 1/0

  4. Glucose Lactose -35 -10 -- + CRPE LacO GFP X Y Standard Lac Operon -35 -10 + + MiCE LacO YFP X Y Lac Operon Type II -35 -10 CRPE XBS CFP Y + -- Glycolysis Regulon (?) -35 -10 -- -- CRPE YBS BFP X Lac Operon Type III

  5. 2:4 Decoder The Lac Operon is both independently positively and negatively regulated. This means that not only must the repressor be removed, but an activator must be present • CRPE- binding site for CRP • CRP- cAMP Receptor Protein (CAP) : bind to cAMP to activate Lac Operon • [cAMP] = 1/[glucose] • LacO-Binding site for LacI • LacI- Repressor of Lac genes; inactivated upon binding of allolactose • _FP-____ Fluorescent Protein (Green, yellow, blue, cyan) • Protein containing chromophores that fluoresce light at specified wavelengths • XBS- Binding Site for X • X- Repressor X • YBS- Binding Site for Y • Y- Repressor Y • MiCE-Binding site for MiC • MiC- transcriptional activator; responds to [Glucose] http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/L/LacOperon.html

  6. Different Constructs • Localization of Decoder • Plasmids vs. Genome • Transcriptional Molecular Switches found in Biology • Lambda Bacteriophage • product coding on both strands of DNA http://books.google.com/books?id=hhrnA-t-sMkC&dq=lambda+bacteriophage&printsec=frontcover&source=in&hl=en&ei=jsH0Sa3RM5iqMuC46LAP&sa=X&oi=book_result&ct=result&resnum=12#PPA33,M1 • S. Typhimurium • Homologous Recombination to disrupt gene coding via invertible switch http://biology.kenyon.edu/BMB/Chime/hinreco/recomast.htm

  7. Phage  Control Region Late Lytic Genes PRM cI cro cII PRE oR3 oR2 oR1 PR cII: Activates at PRE to express cI Cro: Represses at PRM to prevent expression of cI cI: Represses at PR to prevent expression of cro and also lytic genes. Also activates at PRM to continue expression of cI • *Early in infection, cII and Cro are produced from PR. • -If conditions favor cII: • This regulator activates expression of cI, a repressor of the “late” lysis genes, from PRE. • cI, also called l repressor, represses production of Cro from oR2 and oR1 of PR and also “lytic phage genes” from PL resulting in lysogeny. • -If conditions don’t favor cII: • Cro is expressed from PR. • Cro represses expression of cI from oR3 of PRM- allowing expression of lytic phage genes.

  8. P P The Hin Invertible Switch Invertible Region P hin fljB fljA fliC P-O // IR IR Hin Recombinase Repressor H2 flagellin Site-specific recombination P P-O fljB fljA hin fliC // No promoter for fljBA operon No transcription of fljBA No repression of fliC H1 flagellin Inverted Region

  9. Inspired from MOS logic NAND gate • When either A or B are 5v the respective switch closes, making a connection. • If both A and B are 5v Vout is connected to ground (0v) • The arrows designate whether the connection across the transistor is made when the input voltage (Va and Vb) is at 1 or 0. • Building our logic repressors can be used the exact same way as MOS logic. • Expandable, effective on all DNA

  10. Multi-level logic ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT A’ B Protein X ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT B’ A’ ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT X B’ Z (final output) ATTCGATCACAGTACAAAGAGGTTTTA TAAGCTAGTGTCATGTTTCTCCAAAAT A’ X’

  11. Logic equivalent A’ B’ B Z A’ A’ B’

  12. Universal Base • System works as a decoder chassis • Restriction sites in between coding regions allow for the simply removal or insertions of genes http://books.google.com/books?id=YTxKwWUiBeUC&pg=PT45&dq=restriction+sites • Various ‘parts’ may be stored in cDNA expression libraries http://books.google.com/books?id=7C_lCqvkackC&pg=PA287&dq=cDNA+expression+library • You choose inputs, you choose outputs

  13. Expandable • 3:8, 4:16, etc. decoders can be constructed cutting and pasting various parts of negatively and positively regulated operons (Lac) • Limited only by the amount of repressors you can add, and the amount of DNA you can introduce into the cell

  14. Previous iGEM Projects • Davidson-Missouri Western -iGEM 05: created a 3:8 decoder device using anit-swtiches and riboswitches http://openwetware.org/wiki/Davidson:Davidson_2005 -iGEM 06: incorporated hin invertible switch in salmonella to solve pancake problems http://openwetware.org/wiki/Davidson:Davidson_iGEM_2006 -iGEM 07: Used previous work on hin invertible switch to solve the Hamiltonian Path Problem http://parts.mit.edu/igem07/index.php/Davidson_Missouri_W -iGEM 08: Manipulated the lux operon to mimic XOR gates to compute hash functions http://2008.igem.org/Team:Davidson-Missouri_Western *These guys won Gold every year, as well as a myriad of category prizes*

  15. Previous iGEM Projects • UNIPV Pavia • iGEM 08: Experimented with mux and demux logic functions in E. Coli using the lux operon http://2008.igem.org/Team:UNIPV-Pavia/Project

  16. Previous Works • Team in Japan (not affiliated with iGEM) • http://www.sciencenews.org/view/generic/id/37724/title/Bacteria_do_Boolean_logic_ • Uses logic gates post translationally to control production of proteins

  17. Originality • Logic gates to construct a decoder have been implemented in bacteria • An efficient bacterial construct to compute logic functions at the transcriptional level is currently novel. • Can we use catabolite activator proteins? • Using CAPs would be more universal/standard (something iGEM strives for) • Operons and thus repressors are different for different genes so each proejct would have to design a new decoder • CAPs work in the opposite way but bind to the promoter. • Not as wide of variety in CAPs?

  18. CAPs • CAP already well characterized with cAMP • Can we find one more? • The more CAPs there are, the more expandable this idea is • If input is 11 then it will produce 01, 10, and 11 outputs • Pair with repressors http://books.google.com/books?id=17xyknkbAikC&pg=PA59&dq=catabolite+activator+protein http://books.google.com/books?id=MsFkrBY2-5AC&pg=PA364&dq=catabolite+activator+protein

  19. Clocked Memory • Introduce a time domain into bacteria • Toggle flip-flop • Only stores function when high • Set repressors in certain fashions depending on timing • First clock high green could stop repression of gene A • Second clock high could stop repression of gene B • Express total strand to see stored information • Toggle by expressing 2 proteins to change state • Detect that protein to determine which repressor to knock out

  20. So… It seems that the Bacterial Decoder is nothing new. It has been constructed by the Davidson-Missouri Western team in 2005. They’ve spent each succeeding year constructing new logic constructs in E. Coli to solve different problems. Constructing a bacterial decoder that regulates the output at the transcriptional level is currently our only option. D-MW made their decoder regulating at the translational level. A team in Japan (see slide links) made their decoder using post-translational regulation. Things to consider are the pros and cons in transcriptional vs. post-transcriptional regulation. The idea of creating a “universal decoder”- a model decoder in which outputs and inputs may be exchanged with other ‘parts’ would be a novel organism. However since inputs may be of different caliber, and their associated receptors and transcriptional activators extremely specific, the only way this would be a good idea is if we can engineer an operon (sets of operons) and associated regulatory factors that function as a template for all inputs and outputs. This is quite the task because inputs act on different parts of the cell. Inputs like lactose, act on LacI repressors, while inputs such as ions and metals act on cell membrane receptors. With this being said, the task is not impossible, and with a bit of engineering creativity, this model can have a myriad of practical implications. …yeah.

  21. Also…. Another idea, which would also be novel, would be to create not a bacterial cellular decoder, but a bacterial community decoder using quorum molecules of the lux system. If people are interested in this idea, which although is ideologically and conceptually a bit more complex, is easier to construct and has more applications than a single cell decoder, please let me know, and I can explain it in greater detail. It is easier to create cells of specific functions than a single cell that contains all the logic gates of the decoder.

More Related