morey
Uploaded by
61 SLIDES
790 VUES
610LIKES

3rd Quiz, Name, date, email

DESCRIPTION

3rd Quiz, Name, date, email. 1 Pick one of the following two: A)Explain how environmental changes can increase severity of disease B)Why is it useful to be able to follow individual genotypes (strains) of a microbe? 2 Pick one of the following two:

1 / 61

Télécharger la présentation

3rd Quiz, Name, date, email

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. 3rd Quiz, Name, date, email • 1 Pick one of the following two: • A)Explain how environmental changes can increase severity of disease • B)Why is it useful to be able to follow individual genotypes (strains) of a microbe? • 2 Pick one of the following two: • A) What is the likleihood of a host shift for an exotic pathogen? • B)- What are R and avr genes?

  2. “Emergent diseases”:3: exotic pathogens • 99% of times human responsible for their introduction

  3. Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes

  4. California invaded: 1849 A.D. Port Orford Cedar Root Disease 1950s New hybrid root pathogen 1990s Manzanita/madrone die-back Sudden Oak Death 1990s White pine blister rust 1930s Canker-stain of Sycamores 1980’s Dutch Elm Disease 1960s Pitch canker disease 1980s Oak root canker 2000

  5. How can people transport pathogens • By transporting plants and plant parts • Crops, and seeds • Raw food • Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity

  6. The Irish Potato Famine • From 1845 to 1850 • Phytophthora infestans • Resulted in the death of 750,000 • Emigration of over 2 million, mainly to the United States.

  7. What favors invasion of exotic fungi ? • Density of host increases severity of disease _ Presence of related hosts phylogenetic signal) • Corridors linking natural habitats • Synchronicity between host susceptibility and pathogen life cycle • Ecological and environmental conditions • Disturbances • Capacity of pathogen to survive in unfavorable conditions • Transmission rate

  8. Girdling aerial ‘cankers’ removed from roots

  9. Big Sur 2006 K. Frangioso

  10. P. ramorum absent P. ramorum present Wickland et al., unpublished

  11. P. ramorum growing in a Petri dish

  12. Organism new to science • Origin unknown • Biology unknown • Symptoms caused unknown • Immediately though highly regulated

  13. Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada Stem canker Leaf necrosis

  14. Sporangia Phytophthora ramorum Chlamydospores

  15. Is it exotic? • Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism • Many hosts appear to have no resistance at all • Limited geographic distribution

  16. Where does it come from? • It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction

  17. Let’s look at its genetic structure • Need a number of independent and neutral DNA markers • Used AFLP, a technique that scans the entire nuclear genome • Are our isolates the same as the European ones? • Is the genetic structure suggestive of an introduced or native species?

  18. US forest isolates clearly distinct from EU nursery isolates, also have different mating type • Isolates from nurseries in WA, OR, & BC both of the US and EU types • Potential for XXX sex and recombination in US nurseries • US forest population is genetically very homogeneous, trademark of an introduced species

  19. The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGGAGAGAGAGAGAGACTGTACGAGCCCGAGTCTCGCAT

  20. Mating Type A1 A2 A2 Growth Rate Fast Slow Fast

  21. Terminology Genotype Lineage Population

  22. Results of 1st microsatellite study • There actually three distinct (genotypically and phenotypically) lineages of P. ramorum • Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage • Several genotypes but only one lineage in EU nurseries • Three lineages in US nurseries

  23. Was the pathogen first in US forests or in US nurseries? Slide 12

  24. Was the pathogen first in US forests or in US nurseries? Slide 12 nurseries forests

  25. Positive isolation P. ramorum Where was it introduced? • First reports mid 90’s • Pathogen identified in 2000 • By then, the pathogen was widespread • CLUES: severity of symptoms and anedoctal stories

  26. We found same genotypes in nurseries and forests proving origin of wild outbreak

  27. nurseries Introduction phase 1- Escape of pathogen from Infected nursery plants at two locations: Mount Tamalpais (Marin County), and Scott’s Valley (Santa Cruz County) 2- Nurseries and two sites have identical strain composition, but distance between sites is impossible for natural spread of organism

  28. What favors invasion of exotic fungi ? • Density of host increases severity of disease • Corridors linking natural habitats • Synchronicity between host susceptibility and pathogen life cycle • Ecological and environmental conditions

  29. Bay/Oak association Bay Coast Live Oak (no sporulation) Canker margin in phloem Bleeding canker Sporangia

  30. Infectious diseases spread not randomly but around initial infections

  31. Mantel test among all individuals. [Moran’s I vs ln (geographic distance)]

  32. Synchrony pathogen-host Susceptibility of oaks (lesion size)

  33. Wetness > 12 h Temp >19 C

  34. Bay Laurel / Tanoak SOD Spore Survey Temp (C) Rain (mm) Date

  35. How to control emergent exotic diseases • PREVENT THEIR INTRODUCTION • LIMIT THE HUMAN-SPREAD OF PATHOGENS (infected plants, plant parts, dirty tools) • EMPLOY HOST RESISTANCE • CHEMICAL AND OTHER MITIGATION STRATEGIES

  36. Forest pathogens can never be eradicated

  37. PREVENT: Diagnose Symptoms relatively generic, very variable, and pathogen not always culturable LAB CULTURES DNA TESTS

  38. AgriFos and PentraBark Topical Application +

  39. Agrifos vs. Azomite Treatments (efficacy 1 - 24 months) a a Canker Size (mm) b

  40. Why emphasis on molecular analyses? • As a way to identify and quantify microbes in the environment • As a way to understand microbial biology: how do microbes reproduce and infect hosts • As a way to determine epidemiology: follow the movement of a strain

  41. Why emphasis on molecular analyses? • As a way to determine potential for spread: use genes as markers for individuals • As a way to determine whether population of microbes is exotic or native • As a way to identify source of a pathogen and migration patterns

  42. Why emphasis on molecular analyses? • As a way to determine the size of the gene pool of a pathogen, Important to scale management options • As a way to determine rapid evolutionary changes linked to an introduction • As a way to determine epigenetic effects

  43. New host pathogen combinations • Pathogen stays/Plant moves: invasive plant • Pathogen moves/Plant stays: exotic epidemic • Pathogen moves/Plant moves: biological control

  44. Success. The “1:10” rule • Can exotic withstand new environment • Can it withstand attacks of predators • Can it outcompete similar native organisms by accessing resources • Can a pathogen be pathogenic • Can a pathogen be sufficiently virulent

  45. Invasion driven by ecological conditions • Enemy release hypothesis • Resource availability (pathogenicity/virulence)

More Related