3rd Quiz, Name, date, email
3rd Quiz, Name, date, email. 1 Pick one of the following two: A)Explain how environmental changes can increase severity of disease B)Why is it useful to be able to follow individual genotypes (strains) of a microbe? 2 Pick one of the following two:
3rd Quiz, Name, date, email
E N D
Presentation Transcript
3rd Quiz, Name, date, email • 1 Pick one of the following two: • A)Explain how environmental changes can increase severity of disease • B)Why is it useful to be able to follow individual genotypes (strains) of a microbe? • 2 Pick one of the following two: • A) What is the likleihood of a host shift for an exotic pathogen? • B)- What are R and avr genes?
“Emergent diseases”:3: exotic pathogens • 99% of times human responsible for their introduction
Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes
California invaded: 1849 A.D. Port Orford Cedar Root Disease 1950s New hybrid root pathogen 1990s Manzanita/madrone die-back Sudden Oak Death 1990s White pine blister rust 1930s Canker-stain of Sycamores 1980’s Dutch Elm Disease 1960s Pitch canker disease 1980s Oak root canker 2000
How can people transport pathogens • By transporting plants and plant parts • Crops, and seeds • Raw food • Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity
The Irish Potato Famine • From 1845 to 1850 • Phytophthora infestans • Resulted in the death of 750,000 • Emigration of over 2 million, mainly to the United States.
What favors invasion of exotic fungi ? • Density of host increases severity of disease _ Presence of related hosts phylogenetic signal) • Corridors linking natural habitats • Synchronicity between host susceptibility and pathogen life cycle • Ecological and environmental conditions • Disturbances • Capacity of pathogen to survive in unfavorable conditions • Transmission rate
Big Sur 2006 K. Frangioso
P. ramorum absent P. ramorum present Wickland et al., unpublished
Organism new to science • Origin unknown • Biology unknown • Symptoms caused unknown • Immediately though highly regulated
Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada Stem canker Leaf necrosis
Sporangia Phytophthora ramorum Chlamydospores
Is it exotic? • Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism • Many hosts appear to have no resistance at all • Limited geographic distribution
Where does it come from? • It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction
Let’s look at its genetic structure • Need a number of independent and neutral DNA markers • Used AFLP, a technique that scans the entire nuclear genome • Are our isolates the same as the European ones? • Is the genetic structure suggestive of an introduced or native species?
US forest isolates clearly distinct from EU nursery isolates, also have different mating type • Isolates from nurseries in WA, OR, & BC both of the US and EU types • Potential for XXX sex and recombination in US nurseries • US forest population is genetically very homogeneous, trademark of an introduced species
The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGGAGAGAGAGAGAGACTGTACGAGCCCGAGTCTCGCAT
Mating Type A1 A2 A2 Growth Rate Fast Slow Fast
Terminology Genotype Lineage Population
Results of 1st microsatellite study • There actually three distinct (genotypically and phenotypically) lineages of P. ramorum • Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage • Several genotypes but only one lineage in EU nurseries • Three lineages in US nurseries
Was the pathogen first in US forests or in US nurseries? Slide 12
Was the pathogen first in US forests or in US nurseries? Slide 12 nurseries forests
Positive isolation P. ramorum Where was it introduced? • First reports mid 90’s • Pathogen identified in 2000 • By then, the pathogen was widespread • CLUES: severity of symptoms and anedoctal stories
We found same genotypes in nurseries and forests proving origin of wild outbreak
nurseries Introduction phase 1- Escape of pathogen from Infected nursery plants at two locations: Mount Tamalpais (Marin County), and Scott’s Valley (Santa Cruz County) 2- Nurseries and two sites have identical strain composition, but distance between sites is impossible for natural spread of organism
What favors invasion of exotic fungi ? • Density of host increases severity of disease • Corridors linking natural habitats • Synchronicity between host susceptibility and pathogen life cycle • Ecological and environmental conditions
Bay/Oak association Bay Coast Live Oak (no sporulation) Canker margin in phloem Bleeding canker Sporangia
Infectious diseases spread not randomly but around initial infections
Mantel test among all individuals. [Moran’s I vs ln (geographic distance)]
Synchrony pathogen-host Susceptibility of oaks (lesion size)
Wetness > 12 h Temp >19 C
Bay Laurel / Tanoak SOD Spore Survey Temp (C) Rain (mm) Date
How to control emergent exotic diseases • PREVENT THEIR INTRODUCTION • LIMIT THE HUMAN-SPREAD OF PATHOGENS (infected plants, plant parts, dirty tools) • EMPLOY HOST RESISTANCE • CHEMICAL AND OTHER MITIGATION STRATEGIES
PREVENT: Diagnose Symptoms relatively generic, very variable, and pathogen not always culturable LAB CULTURES DNA TESTS
Agrifos vs. Azomite Treatments (efficacy 1 - 24 months) a a Canker Size (mm) b
Why emphasis on molecular analyses? • As a way to identify and quantify microbes in the environment • As a way to understand microbial biology: how do microbes reproduce and infect hosts • As a way to determine epidemiology: follow the movement of a strain
Why emphasis on molecular analyses? • As a way to determine potential for spread: use genes as markers for individuals • As a way to determine whether population of microbes is exotic or native • As a way to identify source of a pathogen and migration patterns
Why emphasis on molecular analyses? • As a way to determine the size of the gene pool of a pathogen, Important to scale management options • As a way to determine rapid evolutionary changes linked to an introduction • As a way to determine epigenetic effects
New host pathogen combinations • Pathogen stays/Plant moves: invasive plant • Pathogen moves/Plant stays: exotic epidemic • Pathogen moves/Plant moves: biological control
Success. The “1:10” rule • Can exotic withstand new environment • Can it withstand attacks of predators • Can it outcompete similar native organisms by accessing resources • Can a pathogen be pathogenic • Can a pathogen be sufficiently virulent
Invasion driven by ecological conditions • Enemy release hypothesis • Resource availability (pathogenicity/virulence)