Chapter 13: Genetic Engineering

Chapter 13: Genetic Engineering

How could you get a desired trait without directly manipulating the organisms’ DNA? • Selective Breeding - choosing organisms withdesired traits to produce the next generation • Breeding the winners of a horse race • Selecting a person with a certain eye color or features • Taking the seeds from the Great Pumpkin

Hybridization • Crossing organisms of different traits to produce a hardier product Ex. A mule is a cross of a horse and a donkey – Sturdy and surefooted Hybrid corn – tastes good and is more resistant to disease. Hybrid potatoes (Burbank)- disease resistant, exported to Ireland to fight blight disease

Inbreeding • Maintaining the present genes bybreeding only within the population • Ex. Pedigree animals • Risk that recessive traits show up that may be lethal or harmful. • Problems with certain breeds, for example hip problems in German shepards

Increasing variations by Inducing mutations By using known mutagens, attempt to force mutations to occur • Radiation & Chemicals • Not a sure bet nor do you know what you are going to get • Polyploidy (3N or 4N) plants have resulted from this – larger & hardier • Bacteria that can digest oil, too

Glofish: the first genetically modified animal to be sold as a pet Researchers in Singapore added a fluorescence gene from a sea coral to zebra danio eggs to produce glofish.

Now let’s manipulate the genes by altering the organism’s DNA • Genetic Engineering – science involved in the ability to manipulate genes/DNA • Purpose: • Cure disease (Cystic Fibrosis) • Treat genetic disorders (Hemophilia, diabetes) • Improve food crops (better tasting, longer shelf life, fungus resistance…) • Improve human life in general

The Tools: • DNA Extraction – Chemical procedure (we’ll do this) • Restriction enzymes– molecular scissors that cut DNA at specific nucleotide sequences • Gel Electrophoresis– method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) • DNA Ligase – molecular glue that puts pieces of DNA together • Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr

Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do? • Inject insulin of course but from what source? • Old method was to use sheep insulin. Costly and labor intensive • New method: Let bacteria with a human insulin producing gene make it for you

The Method: • Transformation of a bacterium to produce human insulin 1. Extract the total genomic DNA from a healthy human 2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA

What are restriction enzymes? • Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). • Different bacterial strains express different restriction enzymes • Restriction enzymes recognize a specific short nucleotide sequence • For example, Eco RI recognizes the sequence: • 5’ - G A A T T C - 3’ • 3’ - C T T A A G - 5’ • Pandindrones same base pairing forward and backwards

Let’s try some cutting: • Using this piece of DNA, cut it with Eco RI • G/AATTC • GACCGAATTCAGTTAATTCGAATTC • CTGGCTTAAGTCAATTAAGCTTAAG • GACCG/AATTCAGTTAATTCG/AATTC • CTGGCTTAA/GTCAATTAAGCTTAA/G

What results is: • GACCG AATTCAGTTAATTCG AATTC • CTGGCTTAA GTCAATTAAGCTTAA G Sticky end - tails of DNA – easily bind to other DNA strands Sticky end

Blunt & Sticky ends • Sticky ends – Creates an overhang. • Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

3. Cut cloning vector: • Use bacterial plasmids • Plasmids will be cut with the same restriction enzyme used to cut the desired gene

4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue. Recombinant DNA - DNA with new piece of genetic information on it • 5. Plasmid is then returned to bacterium and reproduces with donor gene in it. Transgenic organism – organism with foreign DNA incorporated in its genome (genes) • 6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.

Recombinant DNA Donor Gene

Practical Use of DNA technology • Pharmaceutical products – insulin, HBCF (human blood clotting factor) • Genetically engineered vaccines –Introduced viral proteins will trigger an immune response and the production of antibodies

3. Increasing agricultural yields – • New strains of plants – GMO – Genetically modifiedorganism • Insect resistant plants – Insert gene that kills larvae when larvae try to eat the plant – Not always specific to harmful species!! – Monarch problem • Disease resistance – Fungal resistance in tomatoes, corn, soybean • Herbicide resistance - *Round Up won’t harm the good plants, only the bad plants (weeds) – cheaper and less labor extensive than weeding • Getting genes from Nitrogen fixing bacteria inserted into plants – fix their own nitrogen (a must for plants) in N poor soils • Salt tolerant plants – can grow plants where high concentrations of salt in the air or soil

Improve quality of produce - Slow down the ripening process – ship when un-ripened, to market when ripe - Enhance color of produce - Reduce hairs or fuzz on produce - Increase flavor - Frost resistance

Parts of the world with Vitamin A deficiency related health issues

Would you believe that once upon a time carrots were white or purple? Orange-coloured carrots are the product of a mutation selected by a Dutch horticulturist a few hundred years ago because it was the colour of the Dutch Royal House of Orange-Nassau!

The negatives • Problem with transgenic foods is that an introduced gene may produce a protein that someone may be sensitive to. • FDA does not require that on a label (here in the US) • If a label starts with a “(8), then it’s a GMO product – 84011 = GMO banana • Also, may create “superweeds” that cross pollinate with others & may take over environment

Chapter 13: Genetic Engineering