moswen
Uploaded by
26 SLIDES
482 VUES
260LIKES

Ecclesiastes 3:1

DESCRIPTION

Ecclesiastes 3:1 1 To every thing there is a season, and a time to every purpose under the heaven:. Controlling Gene Expression: Bacteria. Timothy G. Standish, Ph. D. All Genes Can’t be Expressed At The Same Time.

1 / 26

Télécharger la présentation

Ecclesiastes 3:1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Ecclesiastes 3:1 1 To every thing there is a season, and a time to every purpose under the heaven:

  2. Controlling Gene Expression:Bacteria Timothy G. Standish, Ph. D.

  3. All Genes Can’t be Expressed At The Same Time • Some gene products are needed for the function of all cells all the time. These permanently expressed genes are called constitutive genes. • Other gene products are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. • For example, bacteria would be wasteful if they made the enzymes necessary to synthesize any given amino acid if that amino acid was readily available to them in their environment

  4. Operons Are Groups Of Genes Expressed By Prokaryotes • Bacterial genes grouped in an operon are all needed to complete a given task • Each operon is controlled by a single control sequence in the DNA • Because the genes are grouped together, they can be transcribed together then translated together

  5. The Lac Operon • Genes in the lac operon allow E. coli bacteria to metabolize lactose • E. coli is unlikely to encounter lactose, so it would be wasteful to produce the proteins needed to metabolize it unless necessary • Metabolizing lactose for energy only makes sense when two criteria are met: • Other more readily metabolized sugar (glucose) is unavailable • Lactose is available

  6. The Lac Operon - Parts • The lac operon is made up of a control region and four genes: • LacZ -b-galactosidase - An enzyme that hydrolizes the bond between galactose and glucose • LacY - Codes for a permease that lets lactose across the cell membrane • LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain • Repressor - A constitutively expressed protein that works with the control region to modulate expression

  7. b-Galactosidease Lac Z gene product HOCH2 H2COH O O Galactose Glucose HO O OH HO OH HO OH H2O Lactose and b-Galactosidease Lactose O-b-D-galactopyranosyl-(1->4)-b-D-glucopyranose

  8. b-Galactosidease Lac Z gene product H2COH HO OH O O Glucose HOCH2 Galactose HO OH OH HO OH HO Lactose and b-Galactosidease Galactose Glucose

  9. The Lac Operon - Control • The control region is made up of two parts: • Promoter • Promoters are specific DNA sequences to which RNA Polymerase binds so that transcription can occur • The lac operon promoter also has a binding site for protein called Catabolite Activator Protein (CAP) • Operator • The binding site of the repressor protein • The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

  10. Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP Binding Repressor Repressor Repressor mRNA Operator The Lac Operon:When Glucose Is Present But Not Lactose Come on, let me through RNA Pol. No way Jose!

  11. Hey man, I’m constitutive RNA Pol. Repressor Promoter LacZ LacY LacA X CAP Binding Repressor Repressor Repressor mRNA Repressor Operator Some transcription occurs, but at a slow rate as efficient transcription requires CAP binding to the promoter The Lac Operon:When Glucose And Lactose Are Present Great, I can transcribe! RNA Pol. Lac This lactose has bent me out of shape

  12. At last we meet CAP my love Hey man, I’m constitutive RNA Pol. RNA Pol. Repressor Promoter LacZ LacY LacA X CAP CAP CAP Binding Repressor Repressor Repressor mRNA Lac cAMP cAMP cAMP Repressor This lactose has bent me out of shape Operator CAP The Lac Operon:When Lactose Is Present But Not Glucose Bind to me Polymerase Yipee…! Hey CAP, let’s get together Genes in the operon are efficiently transcribed

  13. Alright, I’m off to the races . . . Bind to me Polymerase Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP CAP CAP Binding Repressor Repressor Repressor mRNA cAMP cAMP cAMP Operator CAP The Lac Operon:When Neither Lactose Nor Glucose Is Present Come on, let me through! RNA Pol. STOP Right there Polymerase

  14. The Trp Operon • Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan • Trp operon genes encode enzymes involved in the biochemical pathway that converts the precursor chorismate to tryptophan. • The trp operon is controlled in two ways: • Using a repressor that works in exactly the opposite way from the lac operon repressor • Using a special attenuator sequence

  15. 5-Phosphoribosyl- a-Pyrophosphate Glutamine Glutamate + Pyruvate PPi COO- COO- NH2 -OOC Anthranilate synthetase CH2 O C COO- Anthranilate synthetase (trpE and D) HN N-(5’- Phosphoribosyl) -anthranilate O CH2 -2O3P Chorismate H Antrhanilate O H H HO N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) H H H OH OH OH OH OH OH CO2+H2O -2O3PO CH2 -OOC C C C -2O3PO CH2 C C C OH N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase H H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate C H H H C H H N H N H Tryptophan synthetase (trpB and A) Indole-3-glycerol phosphate -OOC C CH2 Glyceraldehyde- 3-phosphate NH3+ Serine H2O N H N H Tryptophan synthetase Indole Tryptophan The TryptophanBiochemical Pathway

  16. Hey man, I’m constitutive Repressor Promo. Lead. Aten. trpE trpD trpC trpB trpA Repressor Repressor mRNA Operator Trp Trp Repressor The Trp Operon:When Tryptophan Is Present Foiled Again! RNA Pol. STOP Right there Polymerase

  17. Hey man, I’m constitutive RNA Pol. Repressor Promo. Lead. Aten. trpE trpD trpC trpB trpA Repressor mRNA Operator Repressor The Trp Operon:When Tryptophan Is Absent RNA Pol. Repressor needs his little buddy tryptophan if I’m to be stopped I need tryptophan

  18. Attenuation • The trp operon is controlled both by a repressor and attenuation • Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes • Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

  19. 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA Ribosome 5’ Transcription And Translation In Prokaryotes

  20. 1 2 3 4 The Trp Leader and Attenuator Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator

  21. 1 2 1 2 3 3 4 4 The mRNA Sequence Can Fold In Two Ways Terminator hairpin

  22. 5’ 3’ Leader peptide 3’ 5’ 2 3 Ribosome 4 1 The Attenuator When Starved For Tryptophan RNA Pol. Help, I need Tryptophan Ribosome stalls over sequence 1 and sequence 2 binds to sequence 3 preventing formation of the 3, 4 hairpin

  23. 5’ 3’ 3’ 5’ Ribosome 1 2 3 4 Leader peptide is released The Attenuator When Tryptophan Is Present RNA Pol. Ribosome passes over sequence 1 and onto sequence 2 allowing sequence 3 to form the 3, 4 hairpin

  24. 5’ 3’ 3’ 5’ Ribosome 1 2 3 4 The Attenuator When Tryptophan Is Present RNA Pol. The 3, 4 hairpin destabilizes the elongation complex

  25. U-rich region acts as a Rho independent terminator 5’ 3’ 3’ 5’ Ribosome RNA polymerase falls off ending transcription 1 2 3 RNA Pol. 4 The Attenuator When Tryptophan Is Present

  26. The End

More Related