nadine
Uploaded by
68 SLIDES
845 VUES
700LIKES

Microbial Genetics

DESCRIPTION

Microbial Genetics. Chromosomes. Chromosome: discrete cellular structure composed of a neatly packaged DNA molecule Eukaryotic chromosomes DNA wound around histones located in the nucleus diploid (in pairs) or haploid (single) linear appearance Prokaryotic chromosomes

1 / 68

Télécharger la présentation

Microbial Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Microbial Genetics

  2. Chromosomes • Chromosome: discrete cellular structure composed of a neatly packaged DNA molecule • Eukaryotic chromosomes • DNA wound around histones • located in the nucleus • diploid (in pairs) or haploid (single) • linear appearance • Prokaryotic chromosomes • DNA condensed into a packet by means of histone-like proteins • single, circular chromosome

  3. Genes Related to Obesity in the Human Genome

  4. Map of E. coli’s ~5000 Genes • Notice it is single & circular • Does E. coli have 1 or 2 alleles of each gene? How do you know? • Humans were first thought to function with 100,000 genes and now the number has dropped to ~35,000 genes although this is still a hot topic in research

  5. Genome • Genome: sum total of genetic material of an organism • most of the genome exists in the form of chromosomes • some appears as plasmids or in certain organelles of eukaryotes • genome of cells composed entirely of DNA • genome of viruses can contain either DNA or RNA E. coli cell disrupted to release its DNA molecule.

  6. Gene • A gene is a segment of DNA that contains the necessary code to make a protein or RNA molecule • Three categories of genes • structural genes: code for proteins • genes that code for RNA machinery used in protein production • regulatory genes: control gene expression Dracunculus vulgaris

  7. Genetic Terms • Genotype • an organism’s genetic makeup; its entire complement of DNA • Phenotype • is the expression of the genes: the proteins of the cell and the properties they confer on the organism. • Size, shape, color, environment

  8. The DNA Code Hydrogen bond H H H N H–N O • Nucleotide: basic unit of DNA structure • phosphate • deoxyribose sugar • nitrogenous base • Nucleotides covalently bond to each other in a sugar-phosphate linkage N C N N–H H G N N O N– H Sugar 3′ H OH P D 5′ 4′ D 1′ 5′ P D C 2′ G P D 3′ P P P O O T A D D O P O P O C G D D O O P P C G D D O P P T A D D O P O P O C G D D O O P P T A P D D P 5′ D D 3′ 5′ H OH CH3 O H N–H N N N A T H– H N N N O H Sugar (a)

  9. Nitrogenous Bases and Base Pairing • Pairing dictated by the formation of hydrogen bonds between bases • Complementary Base Pairing– if sequence of one strand known, sequence of other strand inferred • Try it: TAC GTA ACG ATG CAT TGC Hydrogen bond

  10. Nature of the Double Helix • Antiparallel arrangement: one side of the helix runs in the opposite direction of the other • One side runs from 5’ to 3,’ and the other side runs 3’ to 5’ • This is a significant factor in DNA synthesis and protein production

  11. DNA Replication DNA  DNA

  12. DNA Replication • DNA replication involves unwinding a DNA double helix and using each strand as a template for a new, complementary strand • DNA polymerase and over a dozen other enzymes and proteins are required to successfully replicate a single strand of DNA • DNA replication is semi-conservative since each new chromosome will have one “old” and one “new” strand • When does this occur??

  13. DNA Replication • What is needed to replicate DNA: • Original DNA template • Nucleotides • a pool of nucleotides is free floating in the cytoplasm • Enzymes • DNA polymerase, ligase • Energy • ATP

  14. DNA Replication: Prokaryotes • Certain enzymes unwind the DNA. • Then, DNA polymerase can read the parent strand and attach a complementary nucleotide to the new strand of DNA. • Nucleotides are free in the cytoplasm.

  15. Transcription DNA  RNA

  16. DNA vs. RNA • Contains ribose rather than deoxyribose • RNA is single stranded • There is no T in RNA. Instead it is a U: • A:U in RNA • Can assume secondary and tertiary levels of complexity, leading to specialized forms of RNA (tRNA and rRNA)

  17. Transcription: RNA Synthesis • What you need to synthesize RNA: • Original DNA template: • chromosome with a promoter site (DNA sequence indicating start site) and a terminator site 2. Nucleotides • G, C, A, UUracil is substituted for thymine 3. Enzymes • RNA polymerase 4. Energy • ATP

  18. Transcription • RNA polymerase: large, complex enzyme that directs the conversion of DNA into RNA • Template strand: only one strand of DNA that contains meaningful instructions for synthesis of a functioning polypeptide

  19. Transcription Many types of RNA can be transcribed: • Messenger RNA (mRNA) • RNA molecule that serves as a message of the protein to be produced • Transfer RNA(tRNA) • Transfers amino acids to ribosome • Ribosomal RNA (rRNA) • Forms the ribosome • Regulatory RNA • micro RNAs, anti-sense RNAs, riboswitches, small interfering RNAs

  20. Transcription: Initiation • RNA polymerase recognizes promoter region • RNA polymerase begins its transcription at a special codon called the initiation codon • As the DNA helix unwinds it moves down the DNA synthesizing RNA molecule

  21. Transcription: Elongation Direction of transcription Early mRNA transcript Nucleotide pool • During elongation the mRNA is built, which proceeds in the 5’ to 3’direction (you do not need to know the direction of elongation for this class) • The mRNA is assembled by the adding nucleotides that are complementary to the DNA template. • As elongation continues, the part of DNA already transcribed is rewound into its original helical form.

  22. Transcription: Termination Elongation Late mRNA transcript At termination the polymerases recognize another code that signals the separation and release of the mRNA strand,or transcript.

  23. Practice Transcription • DNA: GCGGTACGCATTAAGCGCCC • RNA:

  24. Translation RNA  Protien

  25. Translation • Decoding the “language” of nucleotides and converting/translating that information into the “language” of proteins. • The nucleic acid “language” is in the form of codons, groups of three mRNA nucleotides. • The protein “language” is in the form of amino acids

  26. Translation • Translation occurs at the ribosome • The green mRNA strand is “threaded” through the ribosome. • The ribosome “reads” the mRNA strand codons with the help of the genetic code and tRNA

  27. tRNA • Decoder molecule which serves as a link to translate the RNA language into protein language • One site of the tRNA has an anticodon which complements the codon of mRNA • The other site of the tRNA has an amino acid attachment site corresponding to a specific amino acid as noted in the genetic code

  28. Translation and the “Genetic Code” • Triplet code that specifies a given amino acid • We use the “genetic code” (at right) to translate mRNA nucleotide sequence (codons) into amino acid sequence which make up proteins. • The “genetic code” is degenerate which allows for a certain amount of mutation. I.e. UUU and UUC both code for Phe

  29. Translation and the “Genetic Code” • There is one start codon, AUG, that codes for the amino acid methionine. • There are 3 stop codons, UAA, UAG and UGA that signal the ribosome to stop translation and let go of the polypeptide chain (protein).

  30. Practice Translation • RNA: CGCCAUGCGUAAUUCGCGGG 1st Step: Find the start of the gene which is always indicated by AUG. Everything upstream from that can be ignored.

  31. Practice Translation • RNA: CGCCAUGCGUAAUUCGCGGG 1st Step: Find the start of the gene which is always indicated by AUG. Everything upstream from that can be ignored.

  32. Practice Translation • RNA: AUG/CGU/AAU/UCG/CGG/G 2nd Step: To make it easier to track the codons I separate each with a slash

  33. Practice Translation • RNA: AUG/CGU/AAU/UCG/CGG/G 3rd Step: Use genetic code to translate mRNA message into amino acid language

  34. Translation at the Molecular Level • Ribosomes bind mRNA near the start codon (ex. AUG) • tRNA anticodon with attached amino acid binds to the start codon

  35. Translation at the Molecular Level • Ribosomes move to the next codon, allowing a new tRNA to bind and add another amino acid

  36. Translation at the Molecular Level • Series of amino acids form peptide bonds

  37. Translation at the Molecular Level • Stop codon terminates translation

  38. Polyribosomal Complex • A single mRNA is long enough to be fed through more than one ribosome • Permits the synthesis of hundreds of protein molecules from the same mRNA transcript • Would you see this in Eukaryotes?

  39. Transcription and Translation in Eukaryotes and Prokaryotes • Similar to prokaryotes except • AUG encodes for a different form of methionine • Transcription and translation are not simultaneous in eukaryotes • Eukaryotes must splice out introns to achieve a mature mRNA strand ready to go to the ribosome.

  40. Gene Regulation • Cells regulate genes in 3 major ways: 1. Feedback inhibition • The end-product inhibits the pathway (similar to a thermostat….when it reaches the desired temperature it turns off) 2. Enzyme induction • If a substrate is present, the enzyme for the substrate is induced. 3. Enzyme repression a. If a nutrient is present, the enzyme to make it is repressed. b. If a nutrient is absent, the enzyme to make it is turned on.

  41. Operons • Only found in bacteria • Coordinated set of genes to make proteins that are needed at the same time • all regulated as a single unit • either inducible or repressible

  42. lac Operon • Most studied operon • When lactose is absent the repressor blocks RNA Polymerase from binding to the operator and transcribing downstream genes. • When lactose is present it binds to the repressor and it falls off the operator allowing RNA Polymerase to bind. • The downstream genes are responsible for digesting lactose and are only on when lactose is present.

  43. Using the lac Operon inGenetic Research • The LacZ gene was knocked into the Nkx2.2 gene to track where Nkx2.2 is expressed in the mouse embryo • You can also use the lac operon to control genes by adding lactose to the system

  44. Phase Variation • Bacteria turn on or off a complement of genes that leads to obvious phenotypic changes • New environment new phenotype! • Most often traits affecting the bacterial cell surface • Examples: • Neisseria gonorrhoeae: production of attachment fimbriae • Streptococcus pneumoniae: production of a capsule

  45. Mutations • A change in the sequence of DNA • Possible effects of mutations • No effect-->no change in a.a. sequence • Good-->new aa. Seq • Increases variability in the gene pool, this is evolution! • Bad-->new aa. Seq • Cancer is the product of a combination of bad mutations.

  46. Types of Mutations • Point Mutation • put the cat out--->puc the cat out • put the cat out--->put • Frameshift (reading frame of mRNA shifts) • put the cat out--->put hec ato ut • Deletion • Addition • Duplication

  47. The Effects of a Point Mutation • When a base is substituted in DNA the mutation may have 2 effects: • Changes the amino acid • Does not change the amino acid • Why doesn’t a mutation always change the amino acid sequence?

  48. The Effects of Frameshift Mutations • The addition, deletion or insertion of one or more nucleotides drastically changes the amino acid sequence.

  49. Mutation Rates • Normal Mutation Rate- 1/1 million per gene • Mutations are constantly occurring since our enzymes are not 100% perfect. • Mutagen- chemical or radiation that bring about mutations. • Mutagen Mutation Rate= 1/1000-1/100,000 per gene (10-1000X the normal rate)

More Related