Microbial Genetics
Microbial Genetics. Chromosomes. Chromosome: discrete cellular structure composed of a neatly packaged DNA molecule Eukaryotic chromosomes DNA wound around histones located in the nucleus diploid (in pairs) or haploid (single) linear appearance Prokaryotic chromosomes
Microbial Genetics
E N D
Presentation Transcript
Chromosomes • Chromosome: discrete cellular structure composed of a neatly packaged DNA molecule • Eukaryotic chromosomes • DNA wound around histones • located in the nucleus • diploid (in pairs) or haploid (single) • linear appearance • Prokaryotic chromosomes • DNA condensed into a packet by means of histone-like proteins • single, circular chromosome
Map of E. coli’s ~5000 Genes • Notice it is single & circular • Does E. coli have 1 or 2 alleles of each gene? How do you know? • Humans were first thought to function with 100,000 genes and now the number has dropped to ~35,000 genes although this is still a hot topic in research
Genome • Genome: sum total of genetic material of an organism • most of the genome exists in the form of chromosomes • some appears as plasmids or in certain organelles of eukaryotes • genome of cells composed entirely of DNA • genome of viruses can contain either DNA or RNA E. coli cell disrupted to release its DNA molecule.
Gene • A gene is a segment of DNA that contains the necessary code to make a protein or RNA molecule • Three categories of genes • structural genes: code for proteins • genes that code for RNA machinery used in protein production • regulatory genes: control gene expression Dracunculus vulgaris
Genetic Terms • Genotype • an organism’s genetic makeup; its entire complement of DNA • Phenotype • is the expression of the genes: the proteins of the cell and the properties they confer on the organism. • Size, shape, color, environment
The DNA Code Hydrogen bond H H H N H–N O • Nucleotide: basic unit of DNA structure • phosphate • deoxyribose sugar • nitrogenous base • Nucleotides covalently bond to each other in a sugar-phosphate linkage N C N N–H H G N N O N– H Sugar 3′ H OH P D 5′ 4′ D 1′ 5′ P D C 2′ G P D 3′ P P P O O T A D D O P O P O C G D D O O P P C G D D O P P T A D D O P O P O C G D D O O P P T A P D D P 5′ D D 3′ 5′ H OH CH3 O H N–H N N N A T H– H N N N O H Sugar (a)
Nitrogenous Bases and Base Pairing • Pairing dictated by the formation of hydrogen bonds between bases • Complementary Base Pairing– if sequence of one strand known, sequence of other strand inferred • Try it: TAC GTA ACG ATG CAT TGC Hydrogen bond
Nature of the Double Helix • Antiparallel arrangement: one side of the helix runs in the opposite direction of the other • One side runs from 5’ to 3,’ and the other side runs 3’ to 5’ • This is a significant factor in DNA synthesis and protein production
DNA Replication DNA DNA
DNA Replication • DNA replication involves unwinding a DNA double helix and using each strand as a template for a new, complementary strand • DNA polymerase and over a dozen other enzymes and proteins are required to successfully replicate a single strand of DNA • DNA replication is semi-conservative since each new chromosome will have one “old” and one “new” strand • When does this occur??
DNA Replication • What is needed to replicate DNA: • Original DNA template • Nucleotides • a pool of nucleotides is free floating in the cytoplasm • Enzymes • DNA polymerase, ligase • Energy • ATP
DNA Replication: Prokaryotes • Certain enzymes unwind the DNA. • Then, DNA polymerase can read the parent strand and attach a complementary nucleotide to the new strand of DNA. • Nucleotides are free in the cytoplasm.
Transcription DNA RNA
DNA vs. RNA • Contains ribose rather than deoxyribose • RNA is single stranded • There is no T in RNA. Instead it is a U: • A:U in RNA • Can assume secondary and tertiary levels of complexity, leading to specialized forms of RNA (tRNA and rRNA)
Transcription: RNA Synthesis • What you need to synthesize RNA: • Original DNA template: • chromosome with a promoter site (DNA sequence indicating start site) and a terminator site 2. Nucleotides • G, C, A, UUracil is substituted for thymine 3. Enzymes • RNA polymerase 4. Energy • ATP
Transcription • RNA polymerase: large, complex enzyme that directs the conversion of DNA into RNA • Template strand: only one strand of DNA that contains meaningful instructions for synthesis of a functioning polypeptide
Transcription Many types of RNA can be transcribed: • Messenger RNA (mRNA) • RNA molecule that serves as a message of the protein to be produced • Transfer RNA(tRNA) • Transfers amino acids to ribosome • Ribosomal RNA (rRNA) • Forms the ribosome • Regulatory RNA • micro RNAs, anti-sense RNAs, riboswitches, small interfering RNAs
Transcription: Initiation • RNA polymerase recognizes promoter region • RNA polymerase begins its transcription at a special codon called the initiation codon • As the DNA helix unwinds it moves down the DNA synthesizing RNA molecule
Transcription: Elongation Direction of transcription Early mRNA transcript Nucleotide pool • During elongation the mRNA is built, which proceeds in the 5’ to 3’direction (you do not need to know the direction of elongation for this class) • The mRNA is assembled by the adding nucleotides that are complementary to the DNA template. • As elongation continues, the part of DNA already transcribed is rewound into its original helical form.
Transcription: Termination Elongation Late mRNA transcript At termination the polymerases recognize another code that signals the separation and release of the mRNA strand,or transcript.
Practice Transcription • DNA: GCGGTACGCATTAAGCGCCC • RNA:
Translation RNA Protien
Translation • Decoding the “language” of nucleotides and converting/translating that information into the “language” of proteins. • The nucleic acid “language” is in the form of codons, groups of three mRNA nucleotides. • The protein “language” is in the form of amino acids
Translation • Translation occurs at the ribosome • The green mRNA strand is “threaded” through the ribosome. • The ribosome “reads” the mRNA strand codons with the help of the genetic code and tRNA
tRNA • Decoder molecule which serves as a link to translate the RNA language into protein language • One site of the tRNA has an anticodon which complements the codon of mRNA • The other site of the tRNA has an amino acid attachment site corresponding to a specific amino acid as noted in the genetic code
Translation and the “Genetic Code” • Triplet code that specifies a given amino acid • We use the “genetic code” (at right) to translate mRNA nucleotide sequence (codons) into amino acid sequence which make up proteins. • The “genetic code” is degenerate which allows for a certain amount of mutation. I.e. UUU and UUC both code for Phe
Translation and the “Genetic Code” • There is one start codon, AUG, that codes for the amino acid methionine. • There are 3 stop codons, UAA, UAG and UGA that signal the ribosome to stop translation and let go of the polypeptide chain (protein).
Practice Translation • RNA: CGCCAUGCGUAAUUCGCGGG 1st Step: Find the start of the gene which is always indicated by AUG. Everything upstream from that can be ignored.
Practice Translation • RNA: CGCCAUGCGUAAUUCGCGGG 1st Step: Find the start of the gene which is always indicated by AUG. Everything upstream from that can be ignored.
Practice Translation • RNA: AUG/CGU/AAU/UCG/CGG/G 2nd Step: To make it easier to track the codons I separate each with a slash
Practice Translation • RNA: AUG/CGU/AAU/UCG/CGG/G 3rd Step: Use genetic code to translate mRNA message into amino acid language
Translation at the Molecular Level • Ribosomes bind mRNA near the start codon (ex. AUG) • tRNA anticodon with attached amino acid binds to the start codon
Translation at the Molecular Level • Ribosomes move to the next codon, allowing a new tRNA to bind and add another amino acid
Translation at the Molecular Level • Series of amino acids form peptide bonds
Translation at the Molecular Level • Stop codon terminates translation
Polyribosomal Complex • A single mRNA is long enough to be fed through more than one ribosome • Permits the synthesis of hundreds of protein molecules from the same mRNA transcript • Would you see this in Eukaryotes?
Transcription and Translation in Eukaryotes and Prokaryotes • Similar to prokaryotes except • AUG encodes for a different form of methionine • Transcription and translation are not simultaneous in eukaryotes • Eukaryotes must splice out introns to achieve a mature mRNA strand ready to go to the ribosome.
Gene Regulation • Cells regulate genes in 3 major ways: 1. Feedback inhibition • The end-product inhibits the pathway (similar to a thermostat….when it reaches the desired temperature it turns off) 2. Enzyme induction • If a substrate is present, the enzyme for the substrate is induced. 3. Enzyme repression a. If a nutrient is present, the enzyme to make it is repressed. b. If a nutrient is absent, the enzyme to make it is turned on.
Operons • Only found in bacteria • Coordinated set of genes to make proteins that are needed at the same time • all regulated as a single unit • either inducible or repressible
lac Operon • Most studied operon • When lactose is absent the repressor blocks RNA Polymerase from binding to the operator and transcribing downstream genes. • When lactose is present it binds to the repressor and it falls off the operator allowing RNA Polymerase to bind. • The downstream genes are responsible for digesting lactose and are only on when lactose is present.
Using the lac Operon inGenetic Research • The LacZ gene was knocked into the Nkx2.2 gene to track where Nkx2.2 is expressed in the mouse embryo • You can also use the lac operon to control genes by adding lactose to the system
Phase Variation • Bacteria turn on or off a complement of genes that leads to obvious phenotypic changes • New environment new phenotype! • Most often traits affecting the bacterial cell surface • Examples: • Neisseria gonorrhoeae: production of attachment fimbriae • Streptococcus pneumoniae: production of a capsule
Mutations • A change in the sequence of DNA • Possible effects of mutations • No effect-->no change in a.a. sequence • Good-->new aa. Seq • Increases variability in the gene pool, this is evolution! • Bad-->new aa. Seq • Cancer is the product of a combination of bad mutations.
Types of Mutations • Point Mutation • put the cat out--->puc the cat out • put the cat out--->put • Frameshift (reading frame of mRNA shifts) • put the cat out--->put hec ato ut • Deletion • Addition • Duplication
The Effects of a Point Mutation • When a base is substituted in DNA the mutation may have 2 effects: • Changes the amino acid • Does not change the amino acid • Why doesn’t a mutation always change the amino acid sequence?
The Effects of Frameshift Mutations • The addition, deletion or insertion of one or more nucleotides drastically changes the amino acid sequence.
Mutation Rates • Normal Mutation Rate- 1/1 million per gene • Mutations are constantly occurring since our enzymes are not 100% perfect. • Mutagen- chemical or radiation that bring about mutations. • Mutagen Mutation Rate= 1/1000-1/100,000 per gene (10-1000X the normal rate)