niveditha
Uploaded by
37 SLIDES
1307 VUES
370LIKES

Polymerase Chain Reaction (PCR2)

DESCRIPTION

Polymerase Chain Reaction (PCR2) fourth lecture Zoology department 2007 Dr.Maha H. Daghestani PCR Definition of PCR Requirements for PCR PCR Process A. Denaturing Stage B. Annealing Stage C. Extending Stage Polymerase Chain Reaction (PCR

1 / 37

Télécharger la présentation

Polymerase Chain Reaction (PCR2)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Polymerase Chain Reaction(PCR2) fourth lecture Zoology department 2007 Dr.Maha H. Daghestani

  2. PCR • Definition of PCR • Requirements for PCR • PCR Process A. Denaturing Stage B. Annealing Stage C. Extending Stage

  3. Polymerase Chain Reaction(PCR • One of the most powerful tools in molecular biology • Invented by Kary Mullis in 1983, resulting in his Nobel Prize in Chemistry • In essence, this process acts as a “copying machine” for DNA

  4. PCR What is it? The Polymerase Chain Reaction (PCR) is an invitro method to amplify a specific region of DNA. PCR is extremely sensitive, with the capability of amplifying minuscule quantities of DNA.

  5. Advances due to PCR -Study DNA sequencing -Compare forensic samples -Identify remains • Disease diagnosis • Paternity determination -Unite living members of a separated family -Determine tissue type for transplants -Amplify cDNA fragments from the reverse transcription products of mRNA (RT-PCR). -Determine the SNPs and mutation in genes

  6. Tools for PCR • A small amount of DNA • DNA polymerace enzymes • Nucleotides • Primers • Two different kind • Usually about 20 nucleotides

  7. REQUIREMENTS • DNA sample · very small amounts (ng or sometimes less) if DNA is in good shape · may be able to use DNA from only one cell · only a few molecules must be intact samples with larger numbers of molecules can be in poor shape or degraded

  8. PCR REQUIREMENTS (cont’d.) • Two primers · flank region you are interested in · you must know the sequence of the flanking regions so you can order appropriate primers • Heat stable polymerase • Four dNTPs • Reaction buffer (Tris, ammonium ions (and/or potassium ions), magnesium ions, bovine serum albumin) • Thermocycler(standard, but optional) · changes temperature very rapidly for each cycle (denature, anneal, extend)

  9. PCR METHOD There are four basic steps in PCR 1. Denaturing Stage 2. Annealing Stage 3. Extending Stage 4. Replication

  10. The basic protocol • Denaturation of DNA to single strands • Annealing of primers to DNA • Extension by polymerase • Repeat 30-35 times

  11. Melting Point Temperature • Denaturation • The more there is G or C, the higher Tm • The longer the primers, the higer Tm

  12. Primers • Usually about 20 nucleotides in length • Designed to flank the region to be amplified • Melting point determined by G-C and A-T content • Tm = 4 (G+C) + 2 (A+T) • Ex: a primer with 10 G/C and 10 A/T would have a Tm of 60oC 4(10) + 2(10)=60oC 5’ 3’ Target DNA 3’ 5’

  13. PCR Primers • Go to Genbank, look up sequence of gene of interest

  14. PCR Primers Identify gene sequence in DNA and mRNA sequence select primers to use for PCR CCAAGGTTGCACCATGGACAGGTGGCAGAAGTGGGATCTCATCCAAGAGTTACATCCCTGCCAAGGTTGCACCATGGACAGGTGGCAGAAGTGGGATCTCATCCAAGAGTTACATCCCTGCCTCTCACTTCCTCTCCTTACAGCCAAGGCTGATGACATTGTTGGCCCTGTGACGCATGACCTCTCACTTCCTCTCCTTACAGCCAAGGCTGATGACATTGTTGGCCCTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAGGAGCCCAATGGTCTAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAGGAGCCCAATGGTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGGTAAGGCCCTTGACTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGGTAAGGCCCTTGACTCTTGGGCATGCCCCTGCACACTTCAGCATGCCCCTTCAGAGTTGCACTTGGTACCTCCTTC

  15. Primers forward 5’ 3’ Target DNA 3’ 5’ reverse

  16. Problems with primers • ”hairpin” structure • If 3’side is included in structure, the primer doesn’t work • Primer dimers • Only harm if the binding is formed at the 3’ends

  17. The basic protocol • Denaturation of DNA to single strands • Annealing of primers to DNA • Extension by polymerase • Repeat 30-35 times

  18. What time does it take? • Denaturation: 30 - 60 sec • Annealing: 30 - 60 sec • Doupling: 30 - 60 sec • 25 - 35 cycles only (otherwise enzyme decay causes artifacts) • 72oC for 5 min at end to allow complete elongation of all product DNA Altogether: 7 min ( 8,5 min) * 25 (35) = 3h-5h

  19. The basic protocol—what’s in the tube 5’ 3’ Target DNA 3’ 5’ A Free nucleotides B primers Buffer containing magnesium Mg2+ Mg2+ Mg2+ Taq DNA polymerase Mg2+ Mg2+ Mg2+

  20. The basic protocol--denaturation 5’ 3’ Target DNA 3’ 5’ 95oC 5’ 3’ 3’ 5’

  21. The basic protocol--annealing 5’ 3’ Target DNA 3’ 5’ A B primers ~55oC 5’ 3’ B 5’ 5’ A 3’ 5’

  22. The basic protocol--extension 5’ 3’ Target DNA 3’ 5’ 72oC 5’ 3’ 5’ Taq polymerase 5’ 3’ 5’

  23. The basic protocol--extension 5’ 3’ Target DNA 3’ 5’ 72oC 5’ 3’ 5’ 5’ 3’ 5’

  24. One One billion in about 2 hours! • At the end of each cycle, the amount of DNA has doubled • By the end of 30 cycles, you will have about 1 billion molecules from the original one you started with!!

  25. What makes it work? • Taq polymerase! • Most enzymes would be killed at 95oC • Taq was isolated from Thermus aquaticus, a bacteria that grows in hot springs (~75oC) • This organism’s enzymes have adapted to the high temperature, so they can survive cycling through the high temperatures

  26. The PCR machine • Very rapidly changes the temperature between the various stages of the PCR process • Programmable for use with many different cycling parameters

  27. Has It Worked? • Check a sample by gel electrophoresis. • Is the product the size that you expected? • Is there more than one band? • Is any band the correct size? • May need to optimize the reaction conditions.

  28. Optimising the PCR Reaction • Annealing temperature of the primers. • The concentration of Mg2+ in the reaction. • The extension time. • (The denaturing and annealing times.) • (The extension temperature.) • (The amount of template and polymerase— “more is less”.)

  29. Theoretical Basis of Agarose Gel Electrophoresis • Agarose is a polysaccharide from marine alage that is used in a matrix to separate DNA molecules • Because DNA ia a (-) charged molecule when subjected to an electric current it will migrate towards a (+) pole

  30. Pouring an Agarose Gel 3 1 2 4 5 6 7 8 9

  31. Assessing the Integrity of DNA High Quality Genomic DNA >95% DNA will be of high molecular weight, migrating as intact band near the top of the gel Very little evidence of smaller fragments indicated by a smear of many different sized DNA fragments

  32. Gene sequencing

  33. Sequencing Wild type Heterozygous

  34. Sequencing Wild type Heterozygous Homozygous

  35. Questions ?

  36. Thank you

More Related