nizana
Uploaded by
63 SLIDES
850 VUES
640LIKES

African Trypanosomes

DESCRIPTION

Regulation of Antigenic Variation. African Trypanosomes. VSG. switch. Antigenic Variation. stochastic. in vitro = in vivo. Immune. destruction. by host. Proliferation. Variant Surface Glycoprotein. 1000 diff variants. Only one expressed. on the surface. 20 nm thick. VSG. switch.

1 / 63

Télécharger la présentation

African Trypanosomes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Regulation of Antigenic Variation African Trypanosomes

  2. VSG switch Antigenic Variation stochastic in vitro = in vivo Immune destruction by host Proliferation Variant Surface Glycoprotein 1000 diff variants Only one expressed on the surface 20 nm thick

  3. VSG switch Regulation of Antigenic Variation Immune destruction by host Proliferation Stochastic No influenced by immune system 1,000 VSG genes VSG VSG genes Telomere VSG expression site

  4. VSG switch Duplicative transposition Regulation of Antigenic Variation Immune destruction by host Proliferation 1,000 VSG genes VSG VSG genes Telomere VSG expression site

  5. VSG switch Duplicative transposition Regulation of Antigenic Variation Immune destruction by host Proliferation 1,000 VSG genes VSG VSG genes Telomere VSG expression site

  6. Antigenic variation systems use subtelomeric localization Telomeric repeat Subtelomere First chromosome- internal gene TTAGGGTTAGGGTTAGGG….. Protect chromosomes: Degradation End-end fusions Benefits of subtelomeric localization: Recognition by DNA repair Reversible gene silencing Loss of info by replication Telomere position effect (TPE) Allow rapid switching and exclusive expression Ectopic recombination Increase gene family diversification Rapid gene switching Why telomeric location ???

  7. Subtelomeric localization of VSG gene in T. brucei VSG X (19) VSG Benefits of subtelomeric localization: Need to regulate both Reversible gene silencing Telomere position effect (TPE) Allow rapid VSG switching and exclusive expression Ectopic recombination Increase gene family diversification Rapid VSG gene switching

  8. Antigenic Variation 7 6 2 1 ESAGs VSG VSG genes 50 bp 70 bp telomeric ~ 1,000 Repetitive DNA sequences

  9. Antigenic Variation 7 6 2 1 (1) VSG VSG genes active X 6 7 2 1 (19) VSG inactive VSG switching 1. Recombination mechanisms duplicative transposition telomeric exchange 2. In situ switch

  10. Antigenic Variation X 7 6 2 1 (19) VSG inactive VSG genes 6 7 2 1 (1) active VSG VSG switching 1. Recombination mechanisms duplicative transposition telomeric exchange 2. In situ switch How to follow switch events ??

  11. Chromosome mapping of switch events Telomere exchange Duplicative transposition WT Null WT Null WT Null 221 1.3 221 1.3 221 1.12 SLOT 221 ES 221 ES Probe 221 1.3 1.12 Laura Cliffe

  12. Why multiple Expression Sites? 6 4 7 2 7 6 2 1 (1) 50 bp 70 bp ESAGs VSG genes X 6 7 2 1 (19) (~200) 177 bp 1. Recombination Dominant mechanism duplicative transposition telomeric exchange 2. In situ switch

  13. Transferrin receptor hetero-dimer Expressed on surface: flagella pocket binds iron

  14. Transferrin receptor in the flagellar pocket Tf-R ESAGs VSG 7 6 5 4 8 3 2 1 VSG surface coat flagellum mitochondrion Tf-R VSG nucleus flagellar pocket kinetoplast Membrane of the flagellar pocket Allows the uptake of iron

  15. Why Multiple Expression Sites ? 6 4 2 7 Cow Each ESAG 6 and 7 in ESs are Slightly different X 7 6 4 2 Dog Resulting in receptors with differing affinities for transferrin from different hosts X 7 6 4 2 Sheep X 7 6 4 2 Human Trypanosomes growing in Cow serum-----------put into dog serum ????

  16. Why Multiple Expression Sites ? ESAG 6 and 7 X 6 4 2 7 Cow Hetero-dimer transferrin receptor 7 6 4 2 Transferrin is an iron containing molecule essential for growth Dog X 7 6 4 2 Each ESAG 6 and 7 are slightly different Sheep X 7 6 4 2 Differences reflected in differing affinities for transferrin Human Experiment: Trypanosomes growing in Cow serum-----------put into dog serum ???? Select for trypanosomes that have switched

  17. Why Multiple Expression sites ? X 6 4 2 7 Cow 7 6 4 2 Dog X 7 6 4 2 Sheep X 7 6 4 2 Human Allowed host range expansion What is the consequence of choice during infection ?

  18. Host range of Trypanosoma brucei Buffalo Spotted hyena Waterbuck Wild dog Buffalo Coke’s Hartebeest Spotted hyena Wild dog Coke’s Hartebeest Waterbuck Eland Lion Giraffe Zebra Reedbuck Giraffe Zebra Reedbuck Eland Lion Warthog Bushbuck Impala Hippo Cattle Warthog Bushbuck Impala Hippo Cattle

  19. Host range of Trypanosoma brucei Buffalo Spotted hyena Waterbuck Wild dog Buffalo Coke’s Hartebeest Spotted hyena Wild dog Coke’s Hartebeest Waterbuck Eland Lion Giraffe Zebra Reedbuck Giraffe Zebra Reedbuck Eland Lion Warthog Bushbuck Impala Hippo Cattle Warthog Bushbuck Impala Hippo Cattle

  20. Multiple ESs leads to multiple Mechanisms 6 4 2 7 (1) 50 bp 70 bp ESAGs VSG genes ~ 1,000 X 6 4 7 2 (19) (>100) 177 bp 1. Recombination Dominant mechanism duplicative transposition telomeric exchange 2. In situ switch Early infection

  21. Mechanisms of VSG Switching Monomorphic Pleomorphic 667, 927 427 Strain Lab adapted Lifecycle Experimental line of choice (?) 10-2 - 10-5 10-6 - 10-7 Switch rate slow rapid Recombination Recombination Switch Mechanism In situ switch In situ switch

  22. Regulation of Antigenic Variation (1) VSG VSG genes active ~ 1,000 X (19) VSG inactive Why is only one expression site active ? ESB localization How are the inactive ESs stably repressed ? Lack of Pol I ?

  23. Regulation of Antigenic Variation (1) VSG VSG genes active ~ 1,000 X (19) VSG inactive Why is only one expression site active ? ESB localization How are the inactive ESs stably repressed ? Lack of Pol I ? Active repression mechanisms chromatin structure ? Regulation of telomeric VSG DNA recombination ? DNA modification chromatin structure

  24. Histone methytransferase Dot1 H3 lysine 76

  25. DNA methylation and histone modification MBP MBP 5MeC DNA binding proteins * * Recruit Histone methylase 3HC 5-methylcytidine

  26. Histone Code Dot1 K79

  27. Chromatin structure X 7 6 2 1 (19) VSG inactive 6 7 2 1 (1) active VSG ISWI (ATPase/helicase) ‘molecular motor’ Slight de-repression of ES transcription

  28. Chromatin structure X 7 6 2 1 (19) VSG inactive 6 7 2 1 (1) active VSG ISWI (ATPase/helicase) Slight de-repression of ES transcription

  29. Dot1: Histone H3K76 methylase X 7 6 2 1 (18) VSG inactive 6 7 2 1 (1) active VSG X 7 6 2 1 VSG inactive Dot1 KO (disruption of telomeric silencing) Slow rate of silencing previously active ES

  30. Dot1: Histone H3K76 methylase X 7 6 2 1 (18) VSG inactive 6 7 2 1 active VSG Slow silencing 7 6 2 1 active VSG Dot1 KO (disruption of telomeric silencing) Slow rate of silencing previously active ES

  31. How are the inactive ESs stably repressed? X X X PvuII PstI PvuII (1) VSG active 1984 PstI PvuII PvuII X (19) inactive Blocked Restriction Sites Within Silent ESs DNA Modification?

  32. The Novel Base J J-DNA Base J Glucose Thymine 1993 J.H. Gommers-Ampt

  33. Consequence of glycosylated DNA ???? J J J J J J J J J J J J J J J J J 70 bp VSG 50 bp J J J J J J J J J J J J J J J J J X J J J J J J J J J J J J J J J J J X

  34. Knock-Out J-Synthesis Pathway in T. brucei 1993 structure (1) VSG active X 1999 (19) localization X 2007 X Base J function Loss of VSG gene regulation ??

  35. Regulation of J-Biosynthesis HOMeUra DNA synthesis Thymidine- hydroxylase Glucosyl- transferase (TH) (GT) HOMedU b-D-glucosyl-HOMedU dT BS PC - + HMU Why do procyclics lack J ? 100 ng Lack thymine hydroxylase (?) 50 25 DNA titration 12 6 3 1.5 Anti-J dot blot

  36. Regulation of J-Biosynthesis HOMeUra DNA synthesis Thymidine- hydroxylase Glucosyl- transferase (TH) (GT) HOMedU b-D-glucosyl-HOMedU dT BS PC - + HMU Why do procyclics lack J ? 100 ng Lack thymine hydroxylase (?) 50 25 DNA titration 12 JBP1 J-DNA binding TH 6 JBP2 TH SWI2/SNF2 3 1.5 Thymine-hydroxylase motif Anti-J dot blot

  37. JBP1 Binds J-DNA and Stimulates J Synthesis JBP1 KO ACCCTAACCCTAACCCTAAC TGGGATTGGGATTGGGATTG Tel-T * Tel-OH Tel-J Tel-T + JBP1 JBP -/- WT -OH ACCCTAACCCTAACCCTAAC TGGGATTGGGATTGGGATTG Tel-OH Bound * DNA titration Glc -O- ACCCTAACCCTAACCCTAAC TGGGATTGGGATTGGGATTG Free Tel-J * Kd = 90 nM J-DNA binding JBP1 H D H R L L L 189 191 239 255 406 411 431 How does it bind J-DNA ??

  38. JBP2 Induces De-Novo J-Synthesis JBP1 JBP2 120 BS PC 85 WT J1KO WT J1 J2 Tubulin Tubulin Phleo GFP JBP array array Anti-GFP JBP1 Stimulate J synthesis J-DNA binding JBP2 SWI2/SNF2 Stimulates de-novo J ATP-dependent 34% identity 47% similarity DNA helicase

  39. JBP2 Induces De-Novo J-Synthesis JBP1 JBP2 120 85 Tubulin Tubulin Phleo GFP JBP array array Anti-GFP BS PC PC WT J1KO WT J1 J2 J2 J2/J1 JBP1 J-DNA binding Propagates J synthesis TH JBP2 SWI2/SNF2 TH Stimulates de-novo J Thymine-hydroxylase motif AlkB-like hydroxylase domain

  40. Thymidine hydroxylase domain of JBP2 / JBP1 ? HO JBP1 JBP2 Thymine Hydroxymethyluracil O2 CO2 + + 2-oxoglutarate Succinate HCHO OH Fe2+ AlkB Thymine 3-methylthymine

  41. Iron and 2-Oxoglutarate Hydroxylase Family Conserved structural fold: eight -strands Iron and Oxoglutarate binding H1-X-D-Xn-H2-Xn-R motif Essential residues Strategy: Mutate JBP1 and JB2 J-DNA binding TH TH SWI2/SNF2 H-X-D-Xn-H-Xn-R H189A D191A H239A Stimulate J-biosynthesis? R255A V258A Zhong Yu et. al., NAR 2007 : Laura Cliffe et. al., NAR 2009

  42. JBP2 Stimulates HOMedU Formation in E. coli Anti-HOMedU IP assay E. coli expression E. coli DNA - + IPTG 7 8 190 7 6 120 6 5 5 4 85 CPM x 104 CPM x 104 4 3 3 60 2 2 50 1 1 0 1 mM 5 mM + HMU -JBP2 IPTG Fe2+ DNA oligos *pHOMedU OH JBP2 12 ..ATTGCT.. ..ATTGCT.. *pA 10 8 CPM x 104 *pT 6 4 *pG 2 Unmod HOMedU Anti-HOMedU IP Robbie Southern

  43. Regulation of J-Synthesis by Two Thymidine Hydroxylases O2 CO2 + + Succinate 2-oxoglutarate Glc O HO Fe2+ GT JBP1 JBP2 J Thymine Hydroxymethyluracil Why are two thymidine hydroxylases needed ??

  44. Deletion of JBP2 and JBP1 Ablates J-Biosynthesis X T T-OH T-O-Glc TH GT +JBP2/ JBP1 J2 J1 ddKO JBP1 dKO JBP2 dKO WT BF +HMU WT PC Glucosyl-transferase still present JBP2 and JBP1 rescue JBP2/JBP1: Thymidine hydroxylases -J dot blot Rudo Kieft and Laura Cliffe

  45. Lack of Base J and Regulation of VSG Expression 221 6 7 2009 (1) Base J function 6 7 X J Null cell line (19) 6 7 X 1. De-regulation of expression sites 2. Increased VSG switching rate 3. Repeat stability

  46. J null cells 7 6 Active 7 6 Active? 7 6 Active? Does J play a role in expression site silencing ? WT cells VSG VSG 7 6 Active J J J J J J J J X VSG VSG 7 6 Silent X J J J J J J J J VSG VSG 7 6 Silent ~90% 6/7 mRNA from 221ES RT-PCR analysis VSG 7 6 Cross-reactive primers

  47. J plays no role in Transcriptional silencing J null cells VSG 7 6 Active X % transcripts from 221 ES VSG 7 6 Silent X VSG 7 6 Silent J null WT Laura Cliffe

More Related