1 / 28

PCR Optimization: Challenges and Successes

PCR Optimization: Challenges and Successes. May 8, 2009 DNA Facility Seminar Series. Outline. Components of the PCR reaction Cycling Conditions Variations on basic PCR. PCR: History. PCR Invention: 1987 Kary Mullis PCR is essentially DNA replication in a tube.

noura
Télécharger la présentation

PCR Optimization: Challenges and Successes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. PCR Optimization: Challenges and Successes May 8, 2009 DNA Facility Seminar Series

  2. Outline • Components of the PCR reaction • Cycling Conditions • Variations on basic PCR

  3. PCR: History PCR Invention: 1987 Kary Mullis PCR is essentially DNA replication in a tube. Series of repetitive steps enabling amplification of target DNA from a complex mixture of DNA

  4. Starting Thoughts • Think about purpose of PCR and downstream applications for your PCR product • Think about “Carry over effect” Set up area keeping in mind PCR has the potential sensitivity to amplify a single molecule

  5. Target dNTP’s Buffer Primers DNA Taq polymerase Denature- 920C-950C (940C) Anneal- 500C-720C Aim for 50C below calculated Tm (520C-580C generally best) Extension - 680C-800C (720C) highest efficiency 700C-800C Basics

  6. Plasmid cDNA (RT-PCR) Genomic DNA Purified (P) Crude Lysate (C) Template P CP C Plasmid Genomic 40ng 10ng 1ng

  7. dNTPs • Mixture of dATP, dCTP, dGTP, dTTP or dUTP Purity- chemical or enzymatic synthesis Stability- concentration – Li or Na salt form

  8. dNTPs • Purity can effect PCR

  9. Buffer All 10x Buffers are not the same • Salt 10-50 mM Tris pH 8.3 • Monovalent cation 100-150 mM KCl or NaCl • Divalent cation 1.5uM or > MgCl2+ Mg2+, Mn2+ • Additives Detergent, Glycerol, Gelatin

  10. Buffer Systems Modifications: Mg pH Ionic strength Additives Mg2+ g Ionic strength g

  11. Buffer Additives • Q-solution-Betaine • DMSO • BSA • Glycerol • Gelatin • PEG • GC-melt • Formamide • Detergents Q D B G P Q/D F D

  12. Primers • Pair complementary to opposite strands 5’g3’ sense primer 3’g5’ anti-sense primer • Features 18-26 nucleotides Equal mix GC to AT bases Match Tm of primers Tm oC= 2(A/T) + 4(G/C) 3’ Stability GG or GC clamps

  13. Additional Considerations • Secondary structure- avoid hairpins, self-dimers, cross-homology • Avoid di-nucleotide repeats that occur consecutively- ATATATAT • Avoid long runs of single bases- ACGGGGGGAT • Avoid cross-homology- BLAST Test

  14. Primer Variation Example PCR 1st Round vary primer pairs Sets A-F A= Primer 1F Primer 1R B= Primer 2F Primer 1R C= Primer 3F Primer 1R D= Primer 1F Primer 2R E= Primer 2F Primer 2R F= Primer 3F Primer 2R Forward primers Primer 1: GAGGGCAGATTCGGGAATG Tm=600c Primer 2: TCGGGAGAGGCCCTTCCC Tm=620c Primer 3: CAGTTTCCCGGGTTCGGC Tm=600c Reverse primers Primer 1: AGCCTAATCAAGTCACTATCAAG Tm=620C Primer 2: GCAAGTGAGAAAATGGGGAG Tm=600C

  15. Considerations: Aim of experiment Thermal stability Processivity Fidelity DNA Taq Polymerases

  16. DNA Taq Polymerases Standard polymerase works for most applications Standard polymerase with loading dye aids in higher through-put Hot Start polymerase inhibits non-specific primer extension Polymerase blends or cocktails combine polymerases for fidelity with speed Taq blend Standard Taq Hot Start Taq

  17. Fidelity • PCR product sequence • PCR product T/A cloned Individual isolates sequenced

  18. PCR Cycling

  19. Modified PCR Methods • Hot Start PCR Manual Hot Start Physical Barrier Modified Taq DNA polymerase Oligo Inhibitors Modified dNTP’s • Semi-Nested or Nested PCR • Touch down PCR

  20. Semi-Nested or Nested-PCR • Specificity g g ----------------------- -------------------- f f • Sensitivity

  21. Additional PCR Methods • Allele-specific PCR • Assembly PCR (PCA) • Breakpoint PCR • Intersequence-specific PCR (ISSR) • Inverse-PCR (IPCR or RE-PCR) • Ligation Mediated PCR (LM-PCR) • Long distance PCR • Multiplex-PCR • Methylation Specific PCR • Mini-primer PCR • Quantitative PCR or Real-time PCR • Reverse Transcriptase PCR (RT-PCR)

  22. RT-PCR • Quality of RNA • Reverse Transcriptase-QC oligo dT random hexamers gene specific primers f

  23. Exon 7 and 8 Exon 9 Exon 3 1 2 3 4 5 6 7 8 9 Exon 5 Exon 1 Exon 2 Exon 6 Exon 4 Multiplex-PCR • Increase throughput • Increase data with limited material

  24. Long-PCR • Analyze large area in single reaction • Tool to analyze inserts and breakpoints 14kb 3kb 1.6kb 20kb

  25. Breakpoint-PCR • Isolate low frequency event

  26. Inverse-PCR and RE-Inverse PCR • Isolate unknown flanking region Digest with restriction enzyme Ligate with T4 DNA ligase

  27. Real-Time PCR or Q-PCR • Increased Sensitivity • Increased Specificity • Increased Throughput

  28. Questions

More Related