Plant Hormones
Plant Hormones. Anjali More University of Arkansas. Why do plants need hormones?. Hormones enable plants to: Respond to environmental factors and changes Direct developmental processes. Why do plants need hormones?. Parasites. Light. Temperature. Pathogens. Humidity. Insects. Stress.
Plant Hormones
E N D
Presentation Transcript
Plant Hormones Anjali More University of Arkansas
Why do plants need hormones? Hormones enable plants to: • Respond to environmental factors and changes • Direct developmental processes
Why do plants need hormones? Parasites Light Temperature Pathogens Humidity Insects Stress Toxins Oxygen
What are hormones? • Harman - “to set in motion” • A chemical messenger from one cell (or group of cells) to another • Signal molecules produced at specific locations • Found in low concentrations • Cause altered processes in target cells at other locations • Found in multicellular organisms
What are plant hormones? • Occur in small amounts • Organic compounds • Synthesized by plants • Active at low concentrations • Promote or inhibit growth and developmental responses • Often show a separation from the site of production and the site of action Plant hormones do not always have all these characteristics Plant growth regulators or plant growth substances
Physiological response Plant hormones are chemical messengers Hormone synthesis Message
General Plant Hormones • Auxins • Cytokinins • Abscisic acid • Ethylene • Gibberellins • Jasmonic acid • Salicylic acid Classical phytohormones
Indole-3-acetic acid (IAA) Auxins • Auxein - to grow • First plant hormone discovered • Occurs in very low concentrations • Confers apical dominance • Regulates developmental processes, e.g. cell division, cell elongation etc Auxin – important for root development
Cytokinins • Stimulates cell division • Lateral bud development • Delays senescence and promotes nutrient uptake Effect of cytokinin application on leaf senescence Rost et al., 1998
Abscisic acid • ‘Abscisin II’- role in abscission • Released during desiccation (of vegetative tissue) • Produced in response to stress • Synthesized in green fruits and seeds • General growth inhibitor – inhibits fruit ripening ABA – The stress hormone www.ars.usda.gov/.../ jan01/acid0101.htm?pf=1
Ethylene • Fruit ripening • Opening of flowers • Induces seed germination • Initiation of stem elongation and bud development Tomato Ethylene treated Banana
Gibberellins • Ubiquitous in both flowering (angiosperms) and non-flowering (gymnosperms) plants as well as ferns • Many forms exist, named GA…GAn in the order of discovery
Discovered in association with foolish seedling disease of rice (“Bakanae”) caused by the fungus, Gibberella fujikuroi. The fungus produces GA. Gibberellins uninfected infected Yabuta and Sumiki, 1938
Gibberellins • Synthesized in the apical portions of both stem and roots • Important effect on stem elongation in plants • Application of gibberellins promotes internode elongation • Involved in many other aspects of plant growth www.school.net.th/.../ science/10000-6600.html
- GA + GA Fewer flowers and larger fruits Delayed harvesting Increased fruit size GAs are commercially used for increased fruit size in table grapes and to regulate citrus flowering and rind maturation Fruit growth – seedless grapes Functions of gibberellins • Cell elongation • Seed germination • Flower induction • Breaking dormancy
Gibberellin mutants • Elongated mutants – constitutive GA response(e.g. spy in arabidopsis)orenhanced GA response(e.g. lv in pea) • Dwarf mutants – three groups • Accumulate GA and mostly unresponsive to applied GA(e.g. gai in arabidopsis) • Reduced GA response but attain full responses with high doses of exogenous (added) GA(e.g. lgr in pea) • Reduced GA response but do not respond to the application of high doses of GA (e.g. lk and lkb in pea) Ross et al. 1997
Dwarf mutants Normal rice (right) and the GA-deficient “superdwarf” mutant. A comparison of 28 day-old plant of the normal and Dwarf-1 mutant in bean Praona and Green, 1967
Significance of GA mutants • Insight into GA biosynthesis and regulation • Help us understand plant growth and development • Sex determination in maize – creation of double mutants • Suitable for production in space…?
GA-deficient “superdwarf” rice and normal wildtype plants – both types are 21 days old Superdwarf Wild type
Physiological response The superdwarf mutation occurs in the late steps of GA synthesis. Other mutations occur at other steps, such as in a hormone receptor. These mutants are valuable tools in studying GA’s role in plant biology. What experiment could we do to distinguish between these two types of mutation, i.e., synthesis or response? Hormone synthesis Transport of hormone
GA exerts its effects on wild type plants – seen here 6 days after treatment with 0 mg/ml or 10 mg/ml GA 0 mg/ml 10 mg/ml
Superdwarf rice, 6 days after treatment with 10 microliters of 0, 1, and 10 mg/ml Gibberellic Acid (GA) 0 mg/ml 1 mg/ml 10 mg/ml
GA-3-beta hydroxylase H GA20 inactive A hydroxylase is an enzyme that adds a hydroxyl group (-OH) to a substrate GA1 active
The rice superdwarf mutant (also called Hosetsu-waisei dwarf from the original Japanese description) is caused by a change in the gene encoding a GA-3b-hydroxylase. NORMAL (wildtype) Superdwarf mutant Deletion of a G residue 5’ 5’ DNA messenger RNA transcription 5’ 5’ translation protein Normal, functional protein The deletion of a G causes a premature “stop” codon – so translation ends early and a full normal protein is not made
Shown is a small portion of the rice GA 3b-hydroxylase gene. The G at nucleotide #750 of the gene is deleted in the superdwarf mutant. This causes a change in the amino acids that are encoded after that point. The letters above the DNA sequence are the one-letter abbreviations for the amino acids that are encoded by each triplet codon. absent in mutant Wildtype sequence V P G L Q L F R R G P D R W V A V P A V 721 gtcccggggctgcagctgttccgtcgagggcccgaccggtgggtggcggtgccggcggtg 780 A G A F V V N V G D L F H I L T N G R F 781 gcgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttc 840 H S V Y H R A V V N R D R D R V S L G Y 841 cacagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctac 900 Mutant sequence V P G L Q L F R R G P T G G W R C R R W 721 gtcccggggctgcagctgttccgtcgaggcccgaccggtgggtggcggtgccggcggtgg 780 R G P S S S T S A T S S T S S P T A A S 781 cgggggccttcgtcgtcaacgtcggcgacctcttccacatcctcaccaacggccgcttcc 840 T A S T T A P S * T A T A T G S R S A T 841 acagcgtctaccaccgcgccgtcgtgaaccgcgaccgcgaccgggtctcgctcggctact 900 Premature “STOP” codon
Using codon tables to determine amino acid sequences encoded by DNA 736 c t g t t c c g t c g a g g g c c c g a c c g g t g g mRNA cuguuccgucga _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A.A. LFRR _ _ _ _ _ C Y F L L I S P T A W H Q R S R N K M V D E G
The experiment: Plant rice seeds – mutant and wildtype. Allow to germinate and then treat with GA at a young age. Can alter volume, concentration, location, plant age, plant species...
These mutants, and others like them, have been considered for use in sustaining space travelers (see www.usu.edu/cpl) . What properties make these plants potentially useful for space travel? Mutant wildtype Plants of the same age