orli
Uploaded by
42 SLIDES
1209 VUES
440LIKES

DNA Fingerprinting

DESCRIPTION

DNA Fingerprinting. Ray McGovern Nabil Hafez John Leonard. November 29, 2004. Overview. DNA Fingerprinting developed by Sir Alec J. Jeffreys, at the University of Leicester, UK. Leicestershire, saw the first exoneration and conviction bases of DNA evidence, in the late 1980s.

1 / 42

Télécharger la présentation

DNA Fingerprinting

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Fingerprinting Ray McGovern Nabil Hafez John Leonard November 29, 2004

  2. Overview • DNA Fingerprinting developed by Sir Alec J. Jeffreys, at the University of Leicester, UK. • Leicestershire, saw the first exoneration and conviction bases of DNA evidence, in the late 1980s. • We will cover: What is DNA Fingerprinting? Courts & Cases Probabilities associated with DNA fingerprinting

  3. Genetics Basics • 100 trillion cells • 23 pairs of chromosomes • 99.9% identical between humans • 0.1 % or 3 million bases accounts for variation • Est. 20,000 – 25,000 genes • Up to hundreds of alleles per gene (blue or brown eyes) Courtesy: DOE

  4. Allelic Differences • Repeats vary from individual to individual but are also inherited • Homozygous vs Heterozygous Courtesy: http://www.howstuffworks.com

  5. Polymorphism = Variation VNTR (minisatellites) • Variable number of tandem repeats • Repeat unit up to 25 bp (unit 20 kb) ACAGGGTGTGGGGACAGGGTGTGGGG vs AGTAGTAGTAGTAGTAGT STR (microsatellites) • Short tandem repeats • repeat unit less than 13 bp (unit <150 bp)

  6. Where do we get the DNA? • Blood - extracted dry or wet (WBC) • Buccal (cheek cells) – easy to obtain • Semen – dried can be analyzed years later • Hair roots • Saliva • Skin cells

  7. RFLP – VNTR based • Restriction Fragment Length Polymorphism Courtesy: http://www.howstuffworks.com

  8. Autoradiograph DNA evidence Suspect 1 Courtesy: http://www.howstuffworks.com

  9. STR (PCR) Typing • Use PCR (polymerase chain reaction) to amplify DNA • Primer sequence from locus region (locus – chromosomal location of genetic marker or repeat) • Obtain Product • Run Gel Courtesy: Fan Sozzi

  10. STR multiplexing • Analyzed by computer and analyst • This one is 8 STR loci on one gel • 1 in 100,000,000 discrimination Courtesy: Genelex

  11. RFLP Older method (80’s) Less sensitive – suitable for blood, requires large amount of high quality DNA Slow: 7-10 days, labor intensive, one gene analyzed at a time Fewer indvidual tests needed, genes examined have >100 alleles high power of discrimation STR (PCR) Newer method (90’s) More sensitive – can use degraded DNA from minute sources Fast: 2-6 days, high throughput, simultaneous analysis of many genes More individual tests needed, genes examined have between 10-15 alles, low power of discrimination RFLP vs STR typing

  12. CODIS(just like on CSI) • Combined DNA Index System • 1997 - National FBI Database composed of 13 STR Loci’s • Probability that DNA from unrelated individuals would generate the same 13 STR profile would be less than 1 in a trillion

  13. Are they guilty? • Bands match, then that suspect is included in the group of individuals from whom the DNA evidence can come from • Bands don’t match, then suspect is excluded from individuals who could have contributed to the DNA evidence • Inconclusive – DNA possibly old or contaminated • Can make no statement of guilt or influence, that is for a jury to decide

  14. The Court Room When determining the admissibility of DNA evidence, courts consider the following questions: • The way the DNA sample(s) were obtained, gathered and preserved. • The qualifications of the experts. • The status of the laboratory. • The reliability of the testing procedure. The majority of the time, “the possibility of laboratory error is substantially larger than the possibility of a coincidental match. This is not because DNA laboratory work is particularly sloppy or unreliable. Instead, it is because the chance of a coincidental match is usually small.”

  15. Fake DNA Evidence Dr. Schneeberger, a Canadian doctor who hading been acquitted of sexually assaulting in 1994, had giving blood on three occasions. He had surgically inserted a Penrose drain, filled with foreign blood and anticoagulants in his arm. This only came to light when the police obtain a sample of his hair and Dr. Schneeberger was convicted in 1995.

  16. Laboratories in Crisis Houston Police Department’s Crime Lab • 280 boxes contained evidence from 8,000 cases, items such as a human fetus, assorted body parts and a host of evidence had been stuffed into the boxes. • This November, it was reviled that DNA evidence from 29 cases was either missing or had been destroyed. • Retesting has put into question the conviction of 15 cases; including 4 death sentences.

  17. Laboratories in Crisis cont. Cellmark Cellmark was awarded a $2.7 million three-year contract to provide DNA testing service to the LA Police Department, in January. In November, Sarah Blair a DNA analyst was fired for substituting data in control samples causing Cellmark to reanalyzed the evidence of several high-profile cases; O.J. Simpson, JonBenet Ramsey, the Unabomber, etc. Other Labs • West Virginia – Fred Zain, the former director was facing fraud charges stemming from testimony provided, when he died in 2003. • Marysville, Washington - In November 2001, Michael Hoover a forensic scientist at the State Patrol crime lab was sentenced to 11 months, after admitting to taking heroin from case evidence; to ease him back pain.

  18. Case Law The admissibility of scientific evidence in the federal court was established Frye v. United States, 1923. The Frye court put forward the "general acceptance" test. State v. Stills – the Supreme Court of New Mexico approved the admissibility of PCR analysis stating that PCR analysis "has received overwhelming acceptance in the scientific community and the courts".

  19. Areas of Statistical Calculations to Considered in DNA Testing Population Genetics • In calculating a probability labs employ databases, which are divided into broad racial categories; comprising of the DNA profile of a few hundred individuals. • These databases are built on the science of Population Genetics. • Murder case in Vermont the defense argued that any DNA evidence should be inadmissible as there was no suitable reference database. The judge agreed, stating “it is unclear which if any of the FBI database is appropriate for calculate probability of a coincidental match.”

  20. Areas of Statistical Calculations to Considered in DNA Testing The Product Rule • The product rule is employed in determining a match. • Guidelines for the application of the product rule are detailed in the Recommendations 4.1 in the Second National Research Council Report (NRC II). “The product rule requires an assumption of within (Hardy-Weinberg or HW) and between (linkage equilibrium or LE) locus independence, which cannot be exactly true.”

  21. The Ceiling Principle and the Modified Ceiling Principle The National Academy of Sciences first recommended the use of the Ceiling Principle back in the late 1980s. The idea was to provide the most conservative estimate of probability but in the mid 1990 it fell out of favor Advances in DNA fingerprinting • In the eighties the number of VNTRs used was small, four or less compared to today when the norm is to employ at least six loci. A Shift in the scientific landscape, • Randjit Chakraborty and Kenneth Kidd defended DNA statistical analysis in their paper entitled The Utility of DNA Typing in Forensic Work. They asserted that even a small amount of migration (gene) across populations is quickly homogenized and contested Lewontin and Hartle’s ideas. • In 1994, Bruce Budowle and Eric Lander published a paper in they concluded that any controversy had been resolved by the Technical Working Group on DNA Analysis Methods (TWGDAM); sponsored by the FBI and the Department of Justice.

  22. Who was Hardy-Weinberg?

  23. Cells, Chromosomes, Genes 23 pairs of chromosomes Each set passed from parents, one from each Inherited characteristics controlled by genes

  24. Inheritance Genes can come in alternative forms, alleles Each controls specific trait, example: eye color brown, green, blue One allele from each parent Dominant vs. Recessive

  25. Recessive: Sickle Cell Anemia Allele causes shape of red blood cells to be altered 2 copies - disease is manifested 1 copy - carrier

  26. Dominant: Huntington’s Disease Progressive, usually mid 30’s Involuntary muscular action and dementia Only 1 copy of allele needed

  27. Two different Genes What happens when at a given locus Both Dominant & Recessive alleles present

  28. The Hardy-Weinberg Equilibrium 1908 Godfrey Harold Hardy - mathematician Wilhelm Weinberg - physician Mathematical equivalent of Mendel’s observations on heredity

  29. Phenotypes: For a gene with 2 alleles, A and a p the population frequency of A q the population frequency of a

  30. Cross Product A a A AA Aa a Aa aa AA = 25% Aa = 50% aa = 25%

  31. Genotypes AA = Aa = Aa =

  32. Restrictions Population size infinite Random mating No selection for or against genotypes No mutations No net migration into or out of population

  33. Applications of Hardy-Weinberg DNA Forensics Population Genetics

  34. Forensics DNA exclusion no match DNA inclusion match but need to relate to population frequencies

  35. Frequency Each allele has an observed frequency Use the product rule Blond hair: 1/10 Blue eyes: 1/10 Fair skin: 1/10 (.10) (.10) (.10) = 1/1000 What about in Scandinavia? Issue of population

  36. Confidence Levels 95% confidence limit, true value has only 5% chance exceeding upper bound If pattern 1/100 Frequency .01 Upper confidence limit 4.7%

  37. Population differences A a Group I - 90% .5 .5 Group II - 10% .9 .1 with random mating AA Aa aa Group I .25 .50 .25 Group II .81 .18 .01

  38. The Results, not that different Observed genotype AA=(.9)(.25)+(.1)(.81) =.306 Aa=(.9)(.5) +(.1)(.18) =.468 aa=(.9)(.25) +(.1)(.01) =.226 Without regard to population substructure A=(.9)(.5)+(.1)(.9) =.54 a=(.9)(.5)+(.1)(.1) =.46 Hardy-Weinberg proportions AA=(.54)(.54) =.2916 Aa=2(.54)(.46) =.4968 aa=(.46)(.46) =.2116 http://www.dartmouth.edu/~chance/teaching_aids/books_articles/DNAtyping/node1.html

  39. Population Genetics Sickle Cell Anemia observed frequency : 0.09 p + q = 1 q = % population with SCA = .09 p = % population with out SCA = .91

  40. Expected Frequencies Genotype frequencies

  41. Conclusion Hardy-Weinberg Equilibrium is a powerful tool Pay attention to its constraints

  42. References • i http://www.bbc.co.uk/crime/caseclosed/colinpitchfork.shtml • ii http://en.wikipedia.org • iii On Conveying the Probative Value of DNA Evidence: Frequencies, Likelihood Ratios, and Error Rates, by Jonathan J. Koehler, The University of Texas at Austin, 20th March 1996 • iv http://www.medterms.com/ • v http://www.cnn.com/2004/TECH/science/11/18/dnalab.ap/index.html • vi http://www.law-forensic.com/cfr_gen_art_24.htm • vii http://www.cellmark-labs.com/ • viii Labs Placed Under a Microscope, by Robert Tanner, The Washington Post, July 27, 2003 • ix http://www.illinoisbar.org/Member/mar00lj/p134.htm#2 • x http://www.kscourts.org/ca10/cases/2001/03/00-2475.htm • xi http://www.forensic-evidence.com/site/EVID/EL_dna_instr_bad.html • xii http://www.fathom.com/course/21701758/session4.html • xiii Interpreting DNA Mixtures Based on the NRC-II Recommendation 4.1, by Wing K. Fung and Yue-Qing Hu, Forensic Science Communication, Volume 2 - Number 4, October 2000 • xiv Commonwealth v. Lanigan, 419 Mass. 15 (1994) • xv Utility of DNA Typing in Forensic Work, by Randjit Chakraborty and Kenneth Kidd, Science 20th December 1991, Vol, 254, Issue 5039 • xvi http://www.nas.edu/ • xvii Use of DNA Profiles in Criminal Proceeding, Alaska Judicial Council, December 1996 • xviii Dr. Shockley and Mr. Hyde, by Joseph Galloway et al, News & World Report, 28th Aug 1989 • xvii http://www.law.berkeley.edu/journals/btlj/articles/vol8/Denemark/html/reader.html • xv Milton R. Wessel, Adversary Science and the Adversary Scientist: Threats to Responsible Dispute Resolution, 28 JURIMETRICS J. 379, 380 (1988).

More Related