orli
Uploaded by
19 SLIDES
335 VUES
190LIKES

Our Test Organism

DESCRIPTION

Our Test Organism. Drosophila simulans. Trait of Interest. Red vs. White. What did we do in lab 1?. Vial of 5 white-eyed females Vial of 6 males, 5 white-eyed With ONE red-eyed male mixed in What is p(red-eye allele)? 1/11 What did we say about the fitness of the red-eyed mutant?

1 / 19

Télécharger la présentation

Our Test Organism

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Our Test Organism Drosophila simulans

  2. Trait of Interest Red vs. White

  3. What did we do in lab 1? • Vial of 5 white-eyed females • Vial of 6 males, 5 white-eyed • With ONE red-eyed male mixed in • What is p(red-eye allele)? • 1/11 • What did we say about the fitness of the red-eyed mutant? • Sensory perception • Should be more fit because has better vision • White eyes = reduced mate tracking

  4. What should we expect to see? • More or less red-eyed flies? • So we have an adaptive allele (red-eyed mutation)… • Should increase in frequency.. What is this called? • Selective sweep • What about polymorphisms located near it? • Hitchhiking • How can we tell if a sweep and hitchhiking has happened?

  5. Genotype the flies near that gene! • Need to first get DNA from the flies (DNA Isolation) • Squish flies to release all their DNA • Need to look at polymorphisms near that gene • Polymerase Chain Reaction • Amplify the DNA of interest enough so we can look at it on a gel Ahhh! Help meeeeeee

  6. Drosophila chromosome What are we going to look at? • Two markers on X-chromosome • One close to the gene for white eyes • One far from the gene for white eyes • Why are we going to look at 2 markers? Red / White eye color gene 22 million bases of DNA 22 million bases of DNA “Near” “Far”

  7. Polymorphisms Recombination Hotspot! • Red: gene mutated to give flies red-eyes • Blue: indel polymorphism • What is an indel polymorphism? • NEAR marker • Yellow: indel polymorphism • FAR marker

  8. Recombination Hotspot! • Who is linked to the red gene? • Blue or yellow? • Say that 1 red-eyed male in the first lab had: • Insertion at the near marker (blue) • Deletion at the far marker (yellow) • All white-eyed individuals had: • Deletion at the near marker (blue) • Insertion at the far marker (yellow) • What will our flies today look like at each marker?

  9. Hypothesis • As chromosomes are passed down over generations, they sometimes “trade pieces” with other chromosomes... (recombination) • More likely to keep the same close neighbor gene variants than far away neighbors. • If natural selection makes one variant spread quickly, itsclose neighbor variants may also spread. This is called genetic hitchhiking

  10. Selective Sweep (positive directional selection) Advantageous mutation # sites # sites 1 2 3 4 1 2 3 4 Frequency in sample Frequency in sample

  11. Before sweep After sweep Selective Sweep/Hitchhiking This is one chromosome from 12 different people. The different colors represent different alleles for that gene. What happened?

  12. Selective Sweep/Hitchhiking If a mutation is advantageous it will likely increase in frequency Why? What will happen to genes/traits that are closely linked to the advantageous mutation? What will happen to genes/traits that are not closely linked to the advantageous mutation?

  13. Variation at 3 loci • 2 variants at the eye color gene • Red & White alleles • 2 variants at the Near marker • High and Low • The red-eyed male from Day 1 has the high allele at Near • The white eyed flies had both variants • 2 variants at the Far marker • High and Low • The red-eyed male from Day 1 has the low allele at Far • The white eyed flies had both variants

  14. How are we going to observe & measure genetic variation? - Microsatellite Markers - Sequence differences (aka variation) between alleles Usually base pair repeats, insertions, or deletions Used for between & within-species comparisons

  15. “Genetic markers” Reference point in the genome with 2+ alleles • A sequence: • AACATGGTGACGGCTAGCA • a sequence: AACATGGTGAGAGAGACGGCTAGCA High allele Low allele

  16. How to tell males from females • Males have black abdomens • Look close at the tip of the male abdomen and you will see his junk • Females have rounded abdomens Female Male

  17. White male Red female White female Red male Sexing your flies: males have a “black butt”, females have large white abdomen

  18. Sexing Female Male

  19. A note about contamination • DO NOT CONTAMINATE YOUR DNA ISOLATIONS! • Change tips in between EACH fly squish! • Just because you can’t see the DNA on the tip, doesn’t mean it’s not there!

More Related