200 likes | 345 Vues
This resource explores the structures and functions of DNA and RNA in the mechanisms of genetics. It covers the components of DNA, including nucleotides and their arrangement, along with the processes of replication, transcription, and translation. Students will learn how mutations occur in DNA and their significance. Through models and practical exercises, learners will grasp how genetic information is conveyed from DNA to RNA and ultimately to proteins. This foundational knowledge is crucial for understanding heredity, biological traits, and genetic variations.
E N D
Objective 2: 6a,b,c Biology: DNA, RNA, Mutation The student knows the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to: • (A) describe components of deoxyribonucleic acid (DNA), and illustrate how information for specifying the traits of an organism is carried in the DNA; • (B)explain replication, transcription, and translation using models of DNA and ribonucleic acid (RNA); • (C) identify and illustrate how changes in DNA cause mutations and evaluate the significance of these changes
P P P P D D T T A D D D D D D C C G G G P P P P A D P P D C Remember THIS? Making a DNA copy of DNA is replication. Cells need to copy their DNA for mitosis(growth, repair, and maintenance). Daughter cells are genetically identical. DNA is also copied for meiosis(reproduction). Daughter cells are genetically different and have ½ the # of chromosomes.
DNA is made of building blocks called nucleotides. They consist of a deoxyribose sugar, a phosphate group and a nitrogen base. The bases are adenine, thymine, guanine, and cytosine. Phosphate group Deoxy-ribose Nitrogen Base
RNA is made of building blocks called nucleotides. They consist of a ribose sugar (instead of a deoxyribose sugar), a phosphate group and a nitrogen base. The bases are adenine, uracil, guanine, and cytosine. Phosphate group ribose Nitrogen Base
What's the difference? DNA RNA Both have adenine, guanine, and cytosine as bases Sugar: ribose Sugar: Deoxyribose Has the base thymine Both have a sugar phosphate backbone. Has the base uracil
Three Types of RNA There are three types of RNA: mRNA-messenger (transcribes DNA) tRNA-transfer (translates mRNA) rRNA-ribosomal (used as a machine for translation)
REPLICATION : DNA copies DNA A T G C http://www.johnkyrk.com/DNAreplication.html http://nobelprize.org/chemistry/educational/dna/b/replication/dna_compounds.html
TRANSCRIPTION: mRNA copies DNA A U G C T A http://www.johnkyrk.com/DNAtranscription.html
TRANSLATION: mRNA is decoded and a protein is made from amino acids. A U G C http://www.johnkyrk.com/DNAtranslation.html
MUTATION: Any change in the DNA sequence. If it is a point mutation (one letter is changed), it can change the amino acid sequence by changing the code. ATC ATG Deletion Point mutation
DNA mRNA Protein In nucleus On ribosome Translation Transcription ATGTGGCAG Let’s try it: 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for. Use the amino acid chart on the next slide.
A-T-G-T-G-G-C-A-G- T Complementary strand that would form in Replication. A C A C C G T C
T-A-C-A-C-C-G-T-C- AUGUGGCAG Methionine Peptide Bonds Tryptophan Glutamine DNA mRNA Amino Acids Transcription Translation
You try it!!! ATGCCATTCAATTAACCCTCC 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for.
Sites to Visit DNA Simulation http://www.johnkyrk.com/DNAanatomy.html Interactive DNA Workshop http://www.pbs.org/wgbh/aso/tryit/dna/index.html