Gene Expression new frontiers

1. Gene Expressionnew frontiers …the processes by which information contained in genes and genomes is decoded by cells, in order to produce molecules that determine the phenotypes observed in organisms, • transcription is controlled so that the correct DNA sequences are expressed as mRNA in the right cells, at the right time, and in the right amount. - and, now we’re learning - - processing and translation of mRNA is further controlled (through RNA/Protein complexes), via ancient, conserved processes.

2. transcription Alt. Splicing Alt. Poly-A, Alt. Translatin Start translation Central Dogma addendum DNA RNA Transcription Factors Protein

3. Transcriptional Network(cell cycle) (example) Science. 2002 Oct 25;298(5594):799-804.

4. TGS transcription PTGS translation Central Dogma addenda DNA TGS: Transcriptional Gene Silencing RNA Transcription Factors Protein PTGS: Post Transcriptional Gene Silencing

5. tiny RNAs(20-to-25 nt RNAs) • in eukaryotic cells, tiny RNAs function as transcriptional regulators of gene expression in (at least) three distinct pathways, • small interfering RNAs (siRNAs) direct RNA destruction via the RNA interference (RNAi) pathway, • and transcriptional regulation via epigenetic processes, • micro (miRNAs) regulate RNA translation.

6. Ancient History (1) Cell75, 843 (1993) Some development timing genes code for short anti-sense molecules, …appeared to be unique to C. elegans.

7. How would a cell express this? miRNAmicro-RNA • Post-transcriptional regulatory “genes”, • contain ~22 nucleotides (processed), • are cleaved from somewhat larger double stranded RNA (dsRNA) precursors - by a protein called Dicer; • are expressed in certain cell types and at certain times during differentiation (also called short temporal (stRNA).

8. miRNA “Anti-Sense” “Sense Strand” Anti-Sense Blocking of Translation Why use RNA to block mRNA function?

9. miRNAs • Conserved amongst eukaryotic cells, • Often associated with hetrochronic genes, • difficult to identify in genomic sequences because they don’t have long ORFs, How might you locate them?

10. Ancient History (II)(co-suppression) Transgene expression often decreases as the copy number of transgenes increased.

11. Gene of Interest Marker Gene (w/P) Active promoter Over Expression Studies • Make a gene construct with, • Structural Gene, • Active promoter (often from a virus promoter), • Marker gene to be able to determine transformation. • Expect, • Higher levels of protein, • Gene-dosage phenotypes, • Glorious publication. Frequent Results: no protein produced, scorn from senior scientists.

12. Gene of Interest tseretnI fo eneG Native promoter mRNA anti-sense RNA 5’ 3’ 5’ 3’ Marker Gene Active promoter Duplex RNA formation. Anti-Sense Studies • Another good idea: use a transgene with the coding sequence reversed...

13. Expected Results • Low, to no detectable single stranded transcript, • Low, to no protein products, • Glorious publication detailing gene function. • Actual Results (Wacky) • Phenotypes ranged from death to over-expression, • Transcript levels were also extremely variable, • Scorn from senior scientists.

14. Co-suppression Modes ...Transcriptional Gene Silencing (TGS), • RNA functions in the methylation of promoters and structural elements of genes, ...Post-Transcritional Gene Silencing (PTGS), • involves the specific degradation of mRNA via a double-stranded RNA intermediate, dsRNA.

15. RNAiRNA interference ...while attempting to do anti-sense KO of gene expression in C. elegans, Guo and Kemphues, Cell 81, 611 (1995) observed that sense and anti-sense strands worked equally, • in an anti-sense experiment, a gene is constructed so that it produces a complementary strand to an expressed transcript, • the goal is to complement, thus inactivate the mRNA. ...following up, other researchers found that dsRNA worked at least an order of magnitude better that either sense or anti-sense strands.

16. RNAi ...siRNA control of gene expression by RNA processing is now considered a common element in eukaryotic cells, • defense against viruses, • control of transposable elements, • adapted to regulate gene expression? • …stolen for doing Reverse Genetic studies, • dsRNA triggers sequence specific degradation of complementary mRNAs.

17. delivery amplification

18. Today Nature 408: 331 - 336

19. Ce III2315 Genes http://www.wormbase.org

20. Functional GenomicsThe Question(s) Can we establish a high throughput system to assign cellular function to genes identified in metazoans? - using cell division and associated processes as the scorable phenotype, • In the process, can we learn about… • cell division genes, • embryology, • general development, • anything else?

21. Differential Interference Contrast Microscopy Nomarski Optics

22. DIC Microscopy Nomarski Optics

23. Reverse GeneticsKnockomics, Knockology... Sequence to Phenotype to Function

24. Forward Reverse Forward vs. Reverse Genetics • Treat thousands of organisms with a mutagen, • random mutagenesis, • Identify an individual with a phenotype of interest, • Identify the gene. • Treat thousands of organisms with a mutagen (usually), • random mutagenesis, or other gene expression block, • Identify individual(s) with a genotype of interest, • Identify the phenotype.

25. Genetically Link Reverse GeneticsFunctional Genomics Function Gene DNA Sequence Phenotype Analysis Gene Disruption Development Physiology Cell Biology

26. New Data, New Technologynew paradigms • The C. elegans genome is sequenced, and we can identify 2315 candidate sequences on Chromosome III. • We can see cell division through a microscope, and further, we are able to identify many abnormalities. • We have RNAi technology at hand to selectively “knock down” any gene we are interested in. Further, RNAi can be added to cells prior to fertilization, mitosis commences after fertilization.

27. Reverse GeneticsDiscovery Research (High Throughput) • Few, if any, hypothesis going in, • High throughput, (2232 genes), • Lots of “negative” results, (87.1% of the genes tested), • Value is in (12.9%)… • the analysis of the data in concert with annotations in the data sets and references in the literature, • the generation of materials for further “hypothesis” - or - “discovery” driven research.

28. gene dsDNA dsRNAs (I)Where do they come from? • PCR primer pairs were designed for each of the genes discovered via bioinformatic analysis of the sequenced chromosome, • and confirmed through EST sequences, or experimental expression studies, • shortest region > 500 bp, or > 90% of ORF.

29. T3 sequence tacked onto the reverse primer. gene 5’ - GTAATACGACTCACTATAGGGGCTAAGCTATTCGATGCTA - 3’ gene specific sequence T7 promoter sequence dsRNAs (II)PCR Primers + • T3 or T7 promoter sequences were included in the PCR primers...

30. T3 and T7 RNA Polymerase • Bacteriophage T3 and T7 RNA polymerases are DNA-dependent RNA polymerases with high sequence specificity for T3 or T7 promoters. • T3 and T7 RNA polymerases synthesize RNA 5' to 3'. • These enzymes are isolated from an overproducing recombinant E. coli clone, and are available commercially.

31. - two reactions - T7 polymerase T3 polymerase sRNA asRNA dsDNA dsRNAs (III)in vitro transcription • T3 and T7 polymerases were used to make single stranded RNA, • sRNA (sense) and asRNA (antisense)…

32. - two reactions - sRNA asRNA T7 polymerase T3 polymerase dsRNA dsDNA dsRNAs (IV)Where do they come from? • sRNA and asRNA are then mixed, and form dsRNA, • Done for 2232 genes, all in 96 well plates...

33. dsRNA ssRNA dsRNAs (VI) x 2232 • Quality control… • Each dsRNA reaction product was run out on a gel, assayed to see if it migrated as a ssRNA or dsRNA based on the estimated size of the product(s)… …ssRNA and ds RNA of the same length migrate differently under electrophoresis.

34. - two reactions - sRNA asRNA T7 polymerase T3 polymerase dsRNA dsDNA dsRNAs (IV)Where do they come from? • sRNA and asRNA are then mixed, and form dsRNA, • Done for 2232 genes, all in 96 well plates...

35. Then What? • dsRNAs (was) injected ... into the gonads of adult wild-type hermaphrodites, which were left at 20 °C for 24 h, • Embryos were then removed and analyzed for potential defects in cell-division processes, capturing 1 image every 5 s using time-lapse Nomarski Differential Interference Contrast (DIC) microscopy, • A minimum of three embryos from three different worms were filmed from shortly after fertilization until the four-cell stage. Database http://fire.biol.wwu.edu/young/470/rnai_movies.html

36. C. elegansLife Cycles

37. And More…Progeny Tests • Three animals were transferred to a fresh plate 24 h after injection, and left at 20 °C. • Two days later, the plate was inspected with a stereomicroscope (20–40x magnification) for the presence of eggs, F1 larvae and their developmental stage (normally L2–L4). • Two days after that, the plate was inspected for the presence of F1 adults (normally >100), their overall body morphology and the presence of F2 progeny. • Partially penetrant embryonic lethality and subtle developmental defects were not scored in this analysis. • dsRNAs that gave rise to defects in less than 5% of the adult progeny were not considered as being associated with a phenotype.

38. But? • It’s supposed to be high throughput, so experiments were designed to minimize the time required, • in part to make the acquisition of so much “meaningless” data palatable (89.1%), • in part because it is a whole lot of work no matter how you approach it, • Remember, along with discovery, this experiment was designed to establish a workable paradigm for future large scale analysis of metazoan (and other complex) organisms.

39. So, Firstestablish reliability • Injected 13 dsRNAs targeted to known components of the cell division process, • all 13 known mutations were observable using DIC photography, • This control tested RNAi efficiency, and the efficacy of DIC phenotype scoring... 13 of 13 genes were disrupted, based on clear DIC image acquisition.

40. 92% Rate deemed acceptable. High Throughput Protocols1st establish acceptable failure rates... • Tried mixing (multiplexing) dsRNA from 2 or more genes...

41. 1. Then did it, 2. Then checked the results... • When a phenotype was observed… • to see which of the two dsRNAs caused the phenotype, fresh worms were injected with the dsRNA (one at a time), • genomic sequence was examined to make sure that only the dsRNA targeted gene was responsible, • Gene families, • Miscalled ORFs.

42. Then checked the results again... Conclusion: “As a result, the DIC phenotypes reported here almost certainly result from inactivation of the expected genes”.

44. For Example... • Makes sense….

45. For Example (II)... • Surprising…so many translation and ribosomal proteins involved meiosis.

46. Forward vs. Reverse Scorecard • 7 of 7 known chromosome III DIC observable, early embryo phenotypes observed, • 9 of 14 late embryo phenotypes observed, • 9 of 31 larvae/adult phenotypes observed. 7 of 7 known, plus 126 new genes!

47. Cousins and Orthologs!Everyone and Metazoans

48. Successful? • High throughput: Yes, • Fidelity: Yes, 7/7, • Discovery: Yes, > 100 new genes involved in early embryo development, especially cell division, • Helpful to Metazoan biologists?

49. Wednesday

50. Presentations