raven
Uploaded by
15 SLIDES
469 VUES
160LIKES

Students ± PV92 Alu Insert

DESCRIPTION

Students ± PV92 Alu Insert. Transposons are “mobile genetic elements” of which there are a great many kinds. Some jump around in genomes. Others jump, but also leave behind copies. Others help their relatives jump.

1 / 15

Télécharger la présentation

Students ± PV92 Alu Insert

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Students ± PV92 Alu Insert

  2. Transposons are “mobile genetic elements” of which there are a great many kinds. Some jump around in genomes. Others jump, but also leave behind copies. Others help their relatives jump. The illustration of generic transposition to the right provides a model of how transposons can lead to genetic disease.

  3. Because of transposition, a great deal of your DNA is repetitive… a | Approximately 45% of the human genome can currently be recognized as being derived from transposable elements, the majority of which are non-long terminal repeat (LTR) retrotransposons, such as LINE-1 (L1), Alu and SVA elements. b | The canonical L1 element consists of two open reading frames (ORF1 and ORF2) flanked by 5' and 3' UTRs. The 5' UTR possesses an internal RNA polymerase II promoter (blue box). The element ends with an oligo(dA)-rich tail (AAA) preceded by a polyadenylation signal (pA). The canonical Alu element consists of two related monomers separated by an A-rich linker region (with consensus sequence A5TACA6). The left monomer contains A and B boxes (blue boxes), which are transcriptional promoters for RNA polymerase III. The element ends with an oligo(dA)-rich tail (AAA) that can be up to 100 bp long. The canonical SVA element has a composite structure consisting of (from the 5' end to 3' end): a (CCCTCT)n hexamer repeat region; an Alu-like region consisting of two antisense Alu fragments and an additional sequence of unknown origin; a variable number of tandem repeats (VNTR) region made of units 35–50 bp in length; and a region derived from the envelope polyprotein (env) gene and the 3' LTR of human endogenous retrovirus (HERV)-K10. The element ends with an oligo(dA)-rich tail preceded by a polyadenylation signal. L1, Alu and SVA elements are typically flanked by target site duplications (black arrows) that are generated upon integration. Elements are not drawn to scale.

  4. Alu is very common… From page 258 of Genomes 3 by Terence A. Brown, 2006

  5. Alu is a SINE • Alu is a “Short Interspersed Nuclear Element.” • These elements get “retrotransposed” from time to time in human history. • Retrotransposition involves an RNA intermediate. • Alu insertions are thought to be important in terms of evolution, but also in terms of genetic disease (0.4% of human genetic diseases). • PV92 is not involved in a genetic disease.

  6. The structure of an Alu element. (a) The top portion shows a genomic Alu element between two direct repeats formed at the site of insertion (red arrowheads). The Alu ends with a long A-run, often referred to as the A-tail, and it also has a smaller A-rich region (indicated by AA) separating the two halves of a diverged dimer structure. Alu elements have the internal components of a RNA polymerase III promoter (boxes A and B), but they do not encode a terminator for RNA polymerase III. They utilize whatever stretch of T nucleotides is found at various distances downstream of the Alu element to terminate transcription. A typical Alu transcript is shown below the genomic Alu, showing that it encompasses the entire Alu, including the A-tail, and has a 3' region that is unique for each locus. (b) The Alu RNA is thought to fold into separate structures for each monomer unit. The RNA has been shown to bind the 7SL RNA SRP9 and 14 heterodimer, as well as polyA-binding protein (PABP). It is thought that at least one other protein binds the duplex portion of the RNA structure. (c) In the target-primed reverse transcription mechanism, the Alu RNA (blue) brings the ORF2p to the genome where its endonuclease activity cleaves at a T-rich consensus sequence. The T-rich region primes reverse transcription by ORF2p on the 3' A-tail region of the Alu element. This creates a cDNA copy of the body of the Alu element. A nick occurs by an unknown mechanism on the second strand and second-strand synthesis is primed. The new Alu element is then flanked by short direct repeats that are duplicates of the DNA sequence between the first and second nicks. Genome Biol. 2011; 12(12): 236. Published online 2011 December 28. doi: 10.1186/gb-2011-12-12-236 PMCID: PMC3334610 Alu elements: know the SINEs Prescott Deininger1

  7. Why so few Alu elements are active: Out of the more than 1 million Alu elements in the human genome, very few are capable of making copies, although many make transcripts. Upon insertion in a new locus, the factors that make a very active Alu element are the flanking sequences influencing the promoter, creating a short unique region. Active elements match the consensus Alu element fairly closely and they have a long and fairly perfect A-tail. Active elements degrade rapidly on an evolutionary time scale by A-tail shortening, heterogeneous base interruptions accumulating in the A-tail, and eventually by the accumulation of random mutations in the Alu element. At least some of these changes alter Alu activity through disruption of the various proteins binding to the RNA in the ribonucleoprotein (See previous image). It is thought that a LINE called L1 can provide the functions Alu needs for retrotransposition. Genome Biol. 2011; 12(12): 236. Published online 2011 December 28. doi: 10.1186/gb-2011-12-12-236 PMCID: PMC3334610 Alu elements: know the SINEs Prescott Deininger1

  8. The PV92 “genetic system” involves an Alu insertion event that has no medical or other ramifications.

  9. PCR Here are the primers we used to copy the stretch of your DNA that lies between them (in our case 600 or 900 bp). Left Primer (aka forward) 5'-AACTGGGAAAATTTGAAGAGAAAGT-3' Right Primer (aka reverse) 5'-ATGGATGTAGTTGGTGTCATGGTCA-3' reverse complement TGACCATGACACCAACTACATCCAT

  10. DNA is Anti-Parallel From Genomes 3 by Terence A. Brown, 2006

  11. Primer Notation Left, Forward, Upstream… 5’-AACTGGGAAAATTTGAAGAGAAAGT-3’ Right, Reverse, Downstream… 5’-ATGGATGTAGTTGGTGTCATGGTCA-3’

  12. The Polymerase Reaction

  13. Paper PCR in Class Activity • Match these primers to the double-stranded DNA on your desk. • Fill in the worksheet. • Remember 5’ 3’ convention

More Related