Center for Integrated Animal Genomics

1. Genetic diversity of the antiviral Mx gene in 14 diverse chicken lines Patricia Davison1, Michael Kaiser2 and Susan J. Lamont2 1 Coe College, Cedar Rapids IA, 2 Animal Science, Iowa State University, Ames IA • Objectives • Evaluate biodiversity of the Mx gene in 14 diverse chicken lines. • Predict amino acid and protein variations in the Mx gene amplicon. • Results • PCR produced 330 base pairs of sequence, 230 bp of reliable sequence. • Poly T chain of variable length and two SNPs (Fig. 1, Table 1). • The first SNP at bp 131 of the amplicon consensus sequence, with variation among lines (Tables 1, 2). • Aligns with Ser631Asn functional SNP (Ko et al., 2002; Tables 1, 2). • Sequence chromatograms of 8(15.1,15.1) line suggested polymorphism in Ser631Asn SNP. Restriction enzyme digest with Hyp8I was used to confirm homozygous Asn allele (Figs. 3, 4). • The broilers were also cut with Hpy8I. Five samples were cut twice. One sample was cut once (Fig. 6). One cut site is at Ser631Asn (Fig. 1). • The Ser631Asn SNP is polymorphic in the HN(12,12) line. Heterozygosity seen on sequence chromatograph and restriction enzyme digest results for two individuals. One individual was homozygous for the viral resistance allele (Figs. 5, 6). • The second SNP is a silent mutation at bp 258 of the amplicon consensus sequence and aligns to 2159 SNP (Ko et al., 2002). • Sequence chromatorgams of 8(15.1,15.1) also suggested polymorphism for the silent SNP. BpmI restriction enzyme digestion confirmed homozygous A allele (Figs. 3, 4). • Illumina SNP data show that HN(12,12) line has heterozygotes in 5 of 12 SNPs in a 2 mb section on each side of the Mx gene (data not shown). • SNPs and poly T chain are in linkage phase in congenic line sets (Table 1). Abstract A natural method of combating Avian Influenza has been previously reported in the form of a Ser631Asn mutation in the chicken Mx gene, where the Asn allele confers viral resistance. The Mx gene of 14 unique, genetically diverse chicken lines was PCR amplified and sequenced. The sequences were aligned and compared to a reference sequence of Red jungle fowl. Two SNPs were found between lines. The first SNP was determined to be Ser631Asn SNP and was polymorphic among the ISU chicken lines as well as within the HN(12,12) line. The second SNP was a silent mutation found across lines. The polymorphism of the Ser631Asn SNP among the chicken lines opens up future studies in phenotypic trials for antiviral resistance. • Introduction • Avian influenza is a major concern to the poultry industry. • Estimated losses of 200 million birds since 2003 from H5N1 viral strain (MSNBC, 2007). • Worries of human outbreak of H5N1 persist (CDC, 2007) with over 270 human cases since 2003 worldwide (MSNBC, 2007). • The interferon induced Mx gene has been associated with viral resistance in chickens (Ko et al., 2002; Fig 2). • A single nucleotide polymorphism (SNP) in Mx produces a 631st amino acid Ser to Asn substitution (Ko et al., 2002). • The Asn allele confers resistance to avian influenza virus. • A section of the Mx gene’s 13th exon (Fig 1) of 14 genetically diverse chicken lines were sequenced. • The sequences were scrutinized for the presence of SNPs, including the functional mutation. Table 1: SNP genotype, Linkage Phase of Mx 13th Exon of Chicken Lines Line Poly T (12th intron) Poly T type Functional SNP bp 131 Silent SNP bp 258 Linkage phase Broiler Male Leghorn Female Spanish Female Fayoumi Female Red Jungle Fowl (1) - TTTTTTTTT 0 CAAGTAA CTCCAGG 0GG - TTTTTTTTT 0 CAAGTAA CTCCAGG 0GG Broiler GHs(13,13) - - - TTTTTTT -2 CAAATAA CTCCAGG -2AG GHs(6,6) - TTTTTTTTT 0 CAAATAA CTCCAGG 0AG M(15.2,15.2) - TTTTTTTTT 0 CAAGTAA CTCCAGG 0GG • Discussion • Chicken lines with the A allele at the functional mutation site at bp 131 code for the amino acid Asn instead of Ser (Tables 1, 2). • This mutation has been previously shown to confer resistance to viruses, such as avian influenza (Ko et al., 2002). • Allelic variation of Mx gene opens possibility of viral resistance in some of these chicken lines. • The Poly T variable length is a phenomenon noted in Livant et al. (2007). • May be unresolved PCR or sequencing artifacts. • May be a genuine line difference, supported by congenic line set consensus of Poly T region. • HN(12,12) birds are inbred full sibs; Polymorphisms are unexpected. • Explanations of errant polymorphism in HN(12,12): DNA sample contamination or sampling, record keeping or mating error. • Ser631Asn polymorphism in HN(12,12) is not experimental error because of agreement among: sequence chromatographs, restriction enzyme results, and SNP Chip database. • The second broiler RE recognition site undetected in sequence data. • Second cut site is probably at the end of the sequence, where it’s poor quality. Fits the small fragment that couldn’t be seen on gel (Fig. 6). M(5.1,5.1) - TTTTTTTTT 0 CAAGTAA CTCCAGG 0GG 19(15.1,15.1) TTTTTTTTTT +1 CAAGTAA CTCCAGG +1GG 19(13,13) TTTTTTTTTT +1 CAAGTAA CTCCAGG +1GG Sp(21.1,21.1) - TTTTTTTTT 0 CAAATAA CTCCAGG 0AG GH(1,1) - - - TTTTTTT -2 CAAATAA CTCCAAG -2AA GH(15.1,15.1) - - - TTTTTTT -2 CAAATAA CTCCAAG -2AA GH(13,13) - - - TTTTTTT -2 CAAATAA CTCCAAG -2AA Poly T Type: 0= 9 Ts; +1= 10 Ts; -2= 7 Ts HN(15,15) - TTTTTTTTT 0 CAAGTAA CTCCAGG 0GG HN(12,12) - TTTTTTTTT 0 CAARTAA CTCCAGG 0RG 8(15.1,15.1) - TTTTTTTTT 0 CAAATAA CTCCAAG 0AA Consensus TTTTTTTTTT +1 CAARTAA CTCCARG n/a Figure 2. Mx gene activation and activity Viral infection -influenza, VSV, etc Figure 4. BpmI restriction enzyme digest of silent Mx SNP for selected chicken lines Figure 3. Putative polymorphism of silent SNP in 8(15.1,15.1) Interferons produced by infected cell - Level of response depends on amount of virus present Lane assignment:1= undigested amplicon; 2-4= HN(15,15)- G, cut; 5-7= GH (13,13)- A, not cut; 8-10=Line 8(15.1,15.1), not cut; Line 8 putative SNP. Mx gene activated Mx gene in chickens- GTPase activity - Protein found mainly in cytoplasm - At least one allele has antiviral activity Figure 6. Hpy8I restriction enzyme digest of functional Mx SNP of selected chicken lines Figure 5. Heterozygous Ser631Asn SNP in HN(12,12) Outcome -Inhibition of viral infection and replication References (1)- Red Jungle Fowl sequence obtained from Ensembl. http://www.ensembl.org/Gallus_gallus/geneview?gene=ENSGALG00000016142#ENSGALT00000025999. Key Facts About Avian Influenza (Bird Flu) and Avian Influenza A (H5N1) Virus. 2007. http://www.cdc.gov/flu/avian/gen-info/facts.htm. accessed 6/11/07. Ko,et.al. 2002. Genome Res. 12: 595-601. Livant, et.al. 2007. An. Gen. 38: 177-179. No sign of deadly avian flu found in U.S.: U.S. Geological Survey detects only mild strain of virus in 75,000 wild birds. 2007.http://www.msnbc.msn.com/id/17169305/. Accessed 7/25/07. Questions and Answers About Avian Influenza (Bird Flu) and Avian Influenza A (H5N1) Virus. 2007. http://www.cdc.gov/flu/avian/gen-info/qa.htm. accessed 6/11/07. Zhou, H. and S.J. Lamont. 1999. An. Gen. 30: 256-264. • Materials and Methods • Purified DNA of 3 individuals from each of 13 inbred lines and 6 broiler individuals. • Inbred chicken lines (99% inbred); 1 Spanish, 2 Fayoumi (Egyptian), 10 Leghorn lines. Broiler line is outbred (Zhou and Lamont 1999). • PCR amplification of the Mx 13th exon, from 12th intron to the 3’ UTR. Forward primer: GAATAGCAACTCCATACCGTG (Livant et al. 2007). The reverse primer was developed by E. Livant and S. Ewald of Auburn University and shared with us. The exact sequence will be released after they have completed their studies with this primer. • The PCR amplicon was quality tested on a 1.5% agarose gel, purified with ExoSapIT and sequenced at the ISU DNA Facility. • Sequence data was processed with Seaquencher and aligned with BioEdit. • Restriction enzyme digests with BpmI and Hpy8I were used to investigate possible SNPs. • Digestion patterns were evaluated via 1.5% agarose gel. Lane assignment: 1= undigested amplicon; 2-4= GHs(6,6)- A, uncut; 5-7= 19(15.1,15.1)- G, cut; 8-10= Line 8(15.1,15.1)- uncut; 11-13= HN(12,12)- 11 and 13: heterozygous, 12: uncut; 14-19= Broilers: 14,15,17,18,19- cut twice; 16- cut once. Acknowledgements Advice about technical procedures and downstream primer sequence was generously provided by E. Livant and S. Ewald of Auburn University. Sara Beth Sherrill, Jason Hasenstein and Jennifer Cheeseman for advice and help. Dr. Rothschild’s lab group, for the use of the computer and Seaquencher program. Author contacts: Patricia Davison- pmdaviso@coe.edu. Susan Lamont: sjlamont@iastate.edu. • Research Experience in Molecular Biotechnology & Genomics • Summer 2007 Center for Integrated Animal Genomics S= Ser; N= Asn; X= polymorphic Program supported by the National Science Foundation Research Experience for Undergraduates DBI-0552371