Translational Inhibition in Arabidopsis thaliana

1. Translational Inhibition in Arabidopsis thaliana Russell Burke Dr. James Carrington Botany and Plant Pathology

2. Significance • microRNAs are 21 to 24 nucleotide RNAs that serve in post-transcriptional regulation in nearly all eukaryotic organisms • They have large roles in growth, development, stress response and antiviral defense in plants • Having a greater knowledge of miRNAs will allow us to better understand growth and development of agriculturally useful plants • microRNA regulation in plants is also very similar to animals and may lead to a better understanding of cancer and other human diseases

3. RNA Silencing Pathways – Basic Mechanisms and Functions RNA Dependent RNA Polymerase dsRNA or RNA foldback Dicer-like Small RNA Duplex Argonaute RNA-induced silencing complex Target mRNA

4. RNA Silencing Pathways – Basic Mechanisms and Functions Major Small RNA Biogenesis and Effector Families RNA Dependent RNA Polymerase RDR1 RDR2 dsRNA or RNA foldback RDR3 RDR4 RDR5 Dicer-like RDR6 Small RNA Duplex DCL1 DCL2 DCL3 Argonaute DCL4 RNA-induced silencing complex AGO2 AGO1 AGO3 AGO6 AGO4 AGO5 AGO7 AGO8 AGO9 AGO10 Target mRNA

5. Small RNA Classes Function Through Sets of ARGONAUTEs tasiRNA (21 nt siRNA) pathway miRNA pathway 24 nt siRNA pathway RDR6 RDR2 DCL4 DCL3 DRB4 DRB Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences SE DCL1 HYL1

6. Small RNA Classes Function Through Sets of ARGONAUTEs tasiRNA (21 nt siRNA) pathway miRNA pathway 24 nt siRNA pathway RDR6 RDR2 DCL4 DCL3 DRB4 DRB Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences SE DCL1 HYL1 ARF8 mRNA An miR167 AGO1 Posttranscriptional silencing

7. Small RNA Classes Function Through Sets of ARGONAUTEs tasiRNA (21 nt siRNA) pathway miRNA pathway 24 nt siRNA pathway RDR6 RDR2 DCL4 DCL3 DRB4 DRB AGO5 AGO3 AGO8 AGO9 Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences SE DCL1 Transcriptional silencing HYL1 ARF8 mRNA An miR167 AGO1 AGO6 AGO2 AGO10 AGO1 AGO4 AGO7 Posttranscriptional silencing

8. Small RNA Classes Function Through Sets of ARGONAUTEs tasiRNA (21 nt siRNA) pathway miRNA pathway 24 nt siRNA pathway RDR6 RDR2 DCL4 DCL3 DRB4 DRB AGO5 AGO3 AGO8 AGO9 Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences Col-0 ago1-25 SE DCL1 HYL1 ARF8 mRNA An miR167 AGO1 AGO1 AGO2 AGO6 AGO4 AGO10 AGO7 Posttranscriptional silencing

9. Translational inhibition found in Arabidopsis mutants Broderson et al. (2008) Science

10. Translational inhibition found in Arabidopsis mutants • Problems with translational inhibition experiment • Protein levels are not quantified • Experiments are done in mutant Arabidopsis plants • Difficult to know all the consequences of anago1 mutant • Only 3 specific cases of potential inhibition are shown Broderson et al. (2008) Science

11. GFP Exogenous Infiltration of Nicotiana benthamiana • Transiently express GFP in N. benthamiana using a 35S promoter • Allows us to express RNA and proteins in a consistent manner • Avoids consequences of AGO1 mutation and other endogenous background • We can use the same microRNA to target various GFP constructs Protein Assay mRNA Analysis

12. Exogenous Infiltration of Nicotiana benthamiana • Designed two different GFP mRNAs, that are both targets of an artificial microRNA • Perfect complementation between the microRNA and mRNA target leads to • cleavage of the mRNA • By changing the serine codon in the target site, the mRNA is not cleaved by the • microRNA

13. Exogenous Infiltration of Nicotiana benthamiana GUS amiR GFP amiR GFP GFP GFPser2 GFP GFPser2 GFP mRNA GFP

14. Exogenous Infiltration of Nicotiana benthamiana GUS amiR GFP amiR GFP GFP GFPser2 GFP GFPser2 GFP mRNA GFP

15. Next steps in GFP translational repression Sensor Constructs TUMV 3’ utr 35S target smGFP SCL6-IV Target SCL6-IV mTarget 5’GATATTGGCGCGGCTCAATCA 3’ ||||||||||||||||||||| 3’CTATAACCGCGCCGAGTTAGT 5’ 5’GATATTGGCGATTCTCAATCA 3’ |||||||||| |||||||| 3’CTATAACCGCGCCGAGTTAGT 5’ miR171 miR171 SPL3 Target SPL3 mTarget 5’TTGCTTACTCTCTTCTGTCA 3’ |||||||||||||||||| 3’CACGAGTGAGAGAAGACAGT 5’ 5’TTGCTTACTAGATTCTGTCA 3’ ||||||| |||||||| 3’CACGAGTGAGAGAAGACAGT 5’ miR156 miR156 CSD1 Target CSD1 mTarget 5’AAGGGGTTTCCTGAGATCACA 3’ ||||||| ||||||| |||| 3’TTCCCCACTGGACTCTTGTGT 5’ 5’AAGGGGTTTCAGTAGATCACA 3’ ||||||| | ||| |||| 3’TTCCCCACTGGACTCTTGTGT 5’ miR398 miR398 CIP4 Target CIP4 mTarget 5’CTACTGCCGCTACTGCTACCA 3’ ||||||||||||||||||| 3’AATGGTGGCGATGACGATGGT 5’ 5’CTACTGCCGCGCATGCTACCA 3’ |||| ||||| ||||||| 3’AATGGTGGCGATGACGATGGT 5’  miR834 miR834 Constructs can be introduced into Arabidopsis where translation of GFP can be analyzed endogenously

16. Acknowledgements • Howard Hughes Medical Institute • Cripps Scholarship Fund, College of Science • Mentors: • Dr. James Carrington • Josh Cuperus • Kevin Ahern