Assembly rules - PowerPoint PPT Presentation

Fundamentals in Sequence Analysis 1.(part 1)

Fundamentals in Sequence Analysis 1.(part 1). Review of Basic biology + database searching in Biology. Hugues Sicotte NCBI. The Flow of Biotechnology Information. Gene. Function. &gt; DNA sequence AATTCATGAAAATCGTATACTGGTCTGGTACCGGCAACAC TGAGAAAATGGCAGAGCTCATCGCTAAAGGTATCATCGAA

★ ★ ★ ★ ★

1.21k views • 75 slides

Community Assembly

Community Assembly. A pervasive theme in community ecology is that the species composition of a community is governed by deterministic “assembly rules” Typically these rules emphasize the importance of interspecific interactions (e.g. niche overlap, body size distributions). Community Assembly.

★ ★ ★ ★ ★

1.34k views • 70 slides

Paleontology in Decline: Making Fossils Live Again

Paleontology in Decline: Making Fossils Live Again. Todd A. Radenbaugh , PhD Research Fellow Canadian Plains Research Center. Geological Society of America 16-19 th ,October, 2005 Salt Lake City, UT.

★ ★ ★ ★ ★

537 views • 28 slides

View Assembly rules PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Assembly rules PowerPoint presentations. You can view or download Assembly rules presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.